Incidental Mutation 'R6170:Crtc2'
ID490363
Institutional Source Beutler Lab
Gene Symbol Crtc2
Ensembl Gene ENSMUSG00000027936
Gene NameCREB regulated transcription coactivator 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R6170 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location90254163-90264125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90259600 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 125 (M125V)
Ref Sequence ENSEMBL: ENSMUSP00000139194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029545] [ENSMUST00000184882]
Predicted Effect probably benign
Transcript: ENSMUST00000029545
AA Change: M210V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029545
Gene: ENSMUSG00000027936
AA Change: M210V

DomainStartEndE-ValueType
Pfam:TORC_N 18 72 1.8e-20 PFAM
low complexity region 127 141 N/A INTRINSIC
Pfam:TORC_M 168 323 3.7e-71 PFAM
low complexity region 335 384 N/A INTRINSIC
low complexity region 391 416 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 484 494 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
Pfam:TORC_C 614 691 4.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149897
Predicted Effect probably benign
Transcript: ENSMUST00000184882
AA Change: M125V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139194
Gene: ENSMUSG00000027936
AA Change: M125V

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:TORC_M 83 239 6.5e-65 PFAM
low complexity region 250 299 N/A INTRINSIC
low complexity region 306 331 N/A INTRINSIC
low complexity region 347 354 N/A INTRINSIC
low complexity region 399 409 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transducers of regulated cAMP response element-binding protein activity family of transcription coactivators. These proteins promote the transcription of genes targeted by the cAMP response element-binding protein, and therefore play an important role in many cellular processes. Under basal conditions the encoded protein is phosphorylated by AMP-activated protein kinase or the salt-inducible kinases and is sequestered in the cytoplasm. Upon activation by elevated cAMP or calcium, the encoded protein translocates to the nucleus and increases target gene expression. Single nucleotide polymorphisms in this gene may increase the risk of type 2 diabetes. A pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating corticosterone levels, hepatocyte secretion of glucose in response to glucagon, and glycogen levels in liver and muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Crtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Crtc2 APN 3 90260805 missense probably damaging 0.98
IGL01874:Crtc2 APN 3 90258508 missense probably damaging 1.00
IGL02220:Crtc2 APN 3 90259148 splice site probably benign
IGL02454:Crtc2 APN 3 90259167 missense probably benign 0.00
IGL02957:Crtc2 APN 3 90262533 missense probably damaging 1.00
R0190:Crtc2 UTSW 3 90259409 missense probably damaging 1.00
R0492:Crtc2 UTSW 3 90263497 missense probably damaging 0.99
R0707:Crtc2 UTSW 3 90263497 missense probably damaging 0.99
R0751:Crtc2 UTSW 3 90262633 nonsense probably null
R1184:Crtc2 UTSW 3 90262633 nonsense probably null
R1521:Crtc2 UTSW 3 90257383 missense probably benign 0.10
R3856:Crtc2 UTSW 3 90262570 missense probably damaging 1.00
R4283:Crtc2 UTSW 3 90259236 splice site probably benign
R4747:Crtc2 UTSW 3 90260211 missense probably damaging 1.00
R5293:Crtc2 UTSW 3 90263564 missense probably benign
R5302:Crtc2 UTSW 3 90261018 missense probably damaging 1.00
R5314:Crtc2 UTSW 3 90261041 nonsense probably null
R6887:Crtc2 UTSW 3 90261071 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACAGGACAAGCTCTGACTC -3'
(R):5'- TCTCCTCAATAGCAGGGACTTG -3'

Sequencing Primer
(F):5'- AGGACAAGCTCTGACTCTGCTC -3'
(R):5'- TCCTCAATAGCAGGGACTTGAAAGAG -3'
Posted On2017-10-10