Incidental Mutation 'R6170:Dmtn'
ID490406
Institutional Source Beutler Lab
Gene Symbol Dmtn
Ensembl Gene ENSMUSG00000022099
Gene Namedematin actin binding protein
SynonymsEpb4.9, dematin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6170 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70601263-70636048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70617355 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 60 (D60G)
Ref Sequence ENSEMBL: ENSMUSP00000153828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022694] [ENSMUST00000022695] [ENSMUST00000110984] [ENSMUST00000226543] [ENSMUST00000227331] [ENSMUST00000228001] [ENSMUST00000228009] [ENSMUST00000228295] [ENSMUST00000228824]
Predicted Effect probably damaging
Transcript: ENSMUST00000022694
AA Change: D60G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022694
Gene: ENSMUSG00000022099
AA Change: D60G

DomainStartEndE-ValueType
Pfam:AbLIM_anchor 8 93 8e-30 PFAM
Pfam:AbLIM_anchor 79 347 1.9e-58 PFAM
VHP 348 383 1.88e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000022695
AA Change: D35G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022695
Gene: ENSMUSG00000022099
AA Change: D35G

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
coiled coil region 188 220 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
VHP 345 380 1.88e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110984
AA Change: D60G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106612
Gene: ENSMUSG00000022099
AA Change: D60G

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 213 245 N/A INTRINSIC
low complexity region 277 292 N/A INTRINSIC
VHP 348 383 1.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226543
Predicted Effect unknown
Transcript: ENSMUST00000227331
AA Change: D13G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227453
Predicted Effect possibly damaging
Transcript: ENSMUST00000228001
AA Change: D35G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000228009
AA Change: D60G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228295
AA Change: D35G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228824
AA Change: D35G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin binding and bundling protein that plays a structural role in erythrocytes, by stabilizing and attaching the spectrin/actin cytoskeleton to the erythrocyte membrane in a phosphorylation-dependent manner. This protein contains a core domain in the N-terminus, and a headpiece domain in the C-terminus that binds F-actin. When purified from erythrocytes, this protein exists as a trimer composed of two 48 kDa polypeptides and a 52 kDa polypeptide. The different subunits arise from alternative splicing in the 3' coding region, where the headpiece domain is located. Disruption of this gene has been correlated with the autosomal dominant Marie Unna hereditary hypotrichosis disease, while loss of heterozygosity of this gene is thought to play a role in prostate cancer progression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a targeted mutation display mild anemia and spherocytosis. Mutant erythrocytes are osmotically fragile and show reduced deformability and filterability as well as increased membrane fragmentation and selective loss of spectrin and actin from RBC membrane skeletons and vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Prlr T C 15: 10,328,849 F470S probably benign Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Dmtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Dmtn APN 14 70604819 missense probably damaging 1.00
IGL02836:Dmtn APN 14 70616078 missense probably damaging 1.00
R1248:Dmtn UTSW 14 70612658 splice site probably benign
R2428:Dmtn UTSW 14 70613403 missense probably damaging 1.00
R3438:Dmtn UTSW 14 70612716 missense probably damaging 0.98
R4851:Dmtn UTSW 14 70604814 missense probably damaging 1.00
R4917:Dmtn UTSW 14 70605719 missense probably damaging 0.98
R4924:Dmtn UTSW 14 70617959 missense probably benign 0.25
R5633:Dmtn UTSW 14 70604979 missense probably benign 0.18
R6214:Dmtn UTSW 14 70613336 missense probably benign 0.05
R6215:Dmtn UTSW 14 70613336 missense probably benign 0.05
R6639:Dmtn UTSW 14 70617430 missense probably damaging 1.00
R6860:Dmtn UTSW 14 70614882 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAACAGTGCTCACTCCTGC -3'
(R):5'- TCTAGTTGCAGAGAGCCTCAGAG -3'

Sequencing Primer
(F):5'- AGTGCTCACTCCTGCGCATAG -3'
(R):5'- TTCAAGGCCAGATGCAGC -3'
Posted On2017-10-10