Incidental Mutation 'R6170:Prlr'
ID490407
Institutional Source Beutler Lab
Gene Symbol Prlr
Ensembl Gene ENSMUSG00000005268
Gene Nameprolactin receptor
SynonymsPrlr-rs1, Pr-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R6170 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location10177238-10349180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10328849 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 470 (F470S)
Ref Sequence ENSEMBL: ENSMUSP00000122219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124470] [ENSMUST00000128450] [ENSMUST00000128921] [ENSMUST00000137867] [ENSMUST00000148257]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000005400
Predicted Effect probably benign
Transcript: ENSMUST00000124470
AA Change: F470S

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122219
Gene: ENSMUSG00000005268
AA Change: F470S

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 342 356 N/A INTRINSIC
low complexity region 384 397 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128450
SMART Domains Protein: ENSMUSP00000122209
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128921
SMART Domains Protein: ENSMUSP00000121280
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137867
SMART Domains Protein: ENSMUSP00000121935
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145428
Predicted Effect probably benign
Transcript: ENSMUST00000148257
SMART Domains Protein: ENSMUSP00000118355
Gene: ENSMUSG00000005268

DomainStartEndE-ValueType
FN3 23 107 3.78e0 SMART
FN3 122 210 2.5e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157020
SMART Domains Protein: ENSMUSP00000120297
Gene: ENSMUSG00000094814

DomainStartEndE-ValueType
transmembrane domain 20 41 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (68/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal growth, hormone and glucose homeostasis, hair cycling, female reproductive behavior, morphology, and function, and thyroid, prostate, Hardarian, and lacrimal gland morphologies. Heterozygous mice exhibit defective neuron proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T A 6: 72,348,572 S90R probably benign Het
4930430A15Rik A G 2: 111,227,948 Y167H probably benign Het
4930523C07Rik C A 1: 160,075,173 N4K possibly damaging Het
5430419D17Rik A T 7: 131,174,487 probably null Het
Adgrl2 A G 3: 148,823,009 S1167P probably damaging Het
Akr1e1 T C 13: 4,602,724 D94G possibly damaging Het
Anln T C 9: 22,368,497 N466D probably benign Het
Atp9b T A 18: 80,877,347 I231L probably benign Het
Bpifb3 T A 2: 153,919,637 M2K unknown Het
Btbd3 T C 2: 138,278,942 L12P probably damaging Het
Btnl6 T A 17: 34,515,506 Y94F probably damaging Het
Cab39 T A 1: 85,818,455 L19* probably null Het
Cacna2d2 A G 9: 107,527,334 D1114G probably damaging Het
Cdh11 A G 8: 102,634,810 V632A probably benign Het
Cemip T G 7: 83,947,230 T1109P possibly damaging Het
Col7a1 C A 9: 108,966,443 P1522Q unknown Het
Colgalt1 C T 8: 71,621,870 L409F probably damaging Het
Crtc2 A G 3: 90,259,600 M125V probably benign Het
Cyp2b19 T G 7: 26,759,094 M78R possibly damaging Het
Cyp4a12a A C 4: 115,327,446 D308A possibly damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Ddah1 A G 3: 145,891,506 D166G probably benign Het
Dmtn T C 14: 70,617,355 D60G probably damaging Het
Dsg1a A T 18: 20,335,986 D607V probably damaging Het
Ebf1 T A 11: 44,883,885 N236K probably damaging Het
Emc1 A G 4: 139,366,378 T600A probably benign Het
Fam205a1 A G 4: 42,849,345 V937A probably benign Het
Fbxo33 T C 12: 59,204,649 N360S probably benign Het
Fbxw5 A G 2: 25,503,603 D72G possibly damaging Het
Fhad1 T A 4: 141,890,952 K1388* probably null Het
Fzd7 A G 1: 59,483,845 M296V probably benign Het
Gdpd3 T C 7: 126,771,164 I257T probably benign Het
Glt28d2 T G 3: 85,871,941 D75A possibly damaging Het
Gm14295 G A 2: 176,811,144 probably benign Het
Gm28729 A G 9: 96,519,441 I98T probably damaging Het
Gm4924 C T 10: 82,377,231 Q288* probably null Het
Gpr150 T C 13: 76,056,557 M90V probably damaging Het
Ireb2 G A 9: 54,887,372 V331I probably benign Het
Kdelc2 T C 9: 53,399,742 V481A possibly damaging Het
Lpcat2b A T 5: 107,433,894 Y363F probably benign Het
Me2 T C 18: 73,785,781 I410V probably benign Het
Naxe T C 3: 88,058,230 E58G probably damaging Het
Nlrp10 T A 7: 108,924,464 D603V probably benign Het
Nlrp1b T A 11: 71,156,079 Y1149F probably damaging Het
Nrg1 A G 8: 31,818,480 Y503H probably damaging Het
Nxpe4 C T 9: 48,392,804 P64S probably benign Het
Pkd1l3 A T 8: 109,623,179 T219S unknown Het
Plagl1 T C 10: 13,127,231 L81P probably damaging Het
Polq A G 16: 37,045,812 Q457R possibly damaging Het
Ppargc1a C A 5: 51,473,911 A459S probably damaging Het
Ppp1r13l A G 7: 19,370,437 D253G probably benign Het
Prl2c2 T A 13: 13,002,172 N55Y probably damaging Het
Serpina12 T C 12: 104,038,241 D44G probably benign Het
Sfxn1 T G 13: 54,106,507 S291R probably benign Het
Sipa1l1 A G 12: 82,341,672 D224G probably benign Het
Slc30a7 A G 3: 115,990,743 F123S probably damaging Het
Stox2 T A 8: 47,192,020 M802L probably benign Het
Tmem150a G A 6: 72,356,745 R30H probably benign Het
Tmem210 G A 2: 25,288,764 probably null Het
Tor3a T C 1: 156,656,573 N269S possibly damaging Het
Trp63 A C 16: 25,884,853 N423T probably benign Het
Vmn2r60 A G 7: 42,135,621 I86V possibly damaging Het
Vmn2r74 T C 7: 85,957,140 I333V probably benign Het
Vwa7 C A 17: 35,021,210 H385N possibly damaging Het
Wdr1 T C 5: 38,529,671 probably null Het
Wdr31 A G 4: 62,463,424 Y57H probably damaging Het
Zbtb44 T A 9: 31,053,382 H29Q probably damaging Het
Zfp532 T A 18: 65,624,438 S481T probably damaging Het
Zfp955b G T 17: 33,302,110 R184S probably benign Het
Other mutations in Prlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prlr APN 15 10328324 missense probably benign 0.00
IGL00688:Prlr APN 15 10322381 unclassified probably benign
IGL01527:Prlr APN 15 10329171 missense probably benign 0.28
IGL01626:Prlr APN 15 10328718 missense probably benign 0.12
IGL01660:Prlr APN 15 10317590 missense probably damaging 1.00
IGL01835:Prlr APN 15 10329043 missense probably damaging 1.00
IGL01926:Prlr APN 15 10314220 start codon destroyed probably null 0.76
IGL01952:Prlr APN 15 10328342 missense possibly damaging 0.95
IGL02306:Prlr APN 15 10328674 missense probably benign 0.05
IGL02394:Prlr APN 15 10328578 missense probably benign 0.03
IGL02430:Prlr APN 15 10325391 missense probably damaging 1.00
IGL02695:Prlr APN 15 10328365 missense probably benign 0.20
IGL02745:Prlr APN 15 10328594 missense possibly damaging 0.50
IGL03193:Prlr APN 15 10328290 missense possibly damaging 0.57
IGL03277:Prlr APN 15 10328801 missense probably benign 0.01
IGL03379:Prlr APN 15 10319317 missense possibly damaging 0.80
R0057:Prlr UTSW 15 10328423 missense probably damaging 0.99
R0057:Prlr UTSW 15 10328423 missense probably damaging 0.99
R0545:Prlr UTSW 15 10317566 missense probably damaging 1.00
R1236:Prlr UTSW 15 10325281 missense probably benign 0.13
R1352:Prlr UTSW 15 10328786 missense probably benign
R1524:Prlr UTSW 15 10319333 missense probably damaging 0.97
R1537:Prlr UTSW 15 10328278 splice site probably null
R1690:Prlr UTSW 15 10317590 missense probably damaging 1.00
R1773:Prlr UTSW 15 10325318 nonsense probably null
R1789:Prlr UTSW 15 10322536 missense probably benign 0.32
R2421:Prlr UTSW 15 10319257 missense probably damaging 1.00
R4518:Prlr UTSW 15 10328999 missense possibly damaging 0.53
R4621:Prlr UTSW 15 10319376 intron probably benign
R4855:Prlr UTSW 15 10328797 missense probably benign 0.01
R4957:Prlr UTSW 15 10319195 missense probably damaging 1.00
R5053:Prlr UTSW 15 10325385 missense probably benign 0.00
R5731:Prlr UTSW 15 10314135 missense probably benign 0.00
R5749:Prlr UTSW 15 10328718 missense probably benign 0.12
R5806:Prlr UTSW 15 10319204 missense probably damaging 1.00
R5927:Prlr UTSW 15 10322446 missense probably benign 0.42
R6911:Prlr UTSW 15 10329184 missense probably benign
R6935:Prlr UTSW 15 10319302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGGCCTTTACCACCTG -3'
(R):5'- ATCCGTGACCCCAGATACCTTG -3'

Sequencing Primer
(F):5'- GCCTTTACCACCTGGCCAAC -3'
(R):5'- GCATACTCCTTACTGGTTTCAGGAAC -3'
Posted On2017-10-10