Incidental Mutation 'R6171:Nek4'
ID490457
Institutional Source Beutler Lab
Gene Symbol Nek4
Ensembl Gene ENSMUSG00000021918
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 4
Synonyms
MMRRC Submission 044314-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R6171 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location30951377-30988821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30970347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 376 (V376A)
Ref Sequence ENSEMBL: ENSMUSP00000057915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050171] [ENSMUST00000226551] [ENSMUST00000228328]
Predicted Effect probably benign
Transcript: ENSMUST00000050171
AA Change: V376A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000057915
Gene: ENSMUSG00000021918
AA Change: V376A

DomainStartEndE-ValueType
S_TKc 6 261 6.93e-91 SMART
low complexity region 429 439 N/A INTRINSIC
low complexity region 627 647 N/A INTRINSIC
low complexity region 751 767 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000226146
AA Change: V251A
Predicted Effect probably benign
Transcript: ENSMUST00000226551
AA Change: V383A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000228328
AA Change: V383A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228392
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase required for normal entry into replicative senescence. The encoded protein also is involved in cell cycle arrest in response to double-stranded DNA damage. Finally, this protein plays a role in maintaining cilium integrity, and defects in this gene have been associated with ciliopathies. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl2 A G 4: 126,317,317 V269A probably damaging Het
Atp11a T A 8: 12,832,663 V517D probably damaging Het
Atr C T 9: 95,881,271 Q1073* probably null Het
C87436 A C 6: 86,445,467 T8P probably benign Het
Clasrp T C 7: 19,584,822 probably benign Het
Creb3l1 G T 2: 91,991,269 Q254K probably damaging Het
Dapl1 C A 2: 59,496,602 T64K probably benign Het
Dnah2 A T 11: 69,423,042 L4168Q probably damaging Het
Dnttip2 T A 3: 122,278,862 I597N probably damaging Het
Dyrk1b A T 7: 28,186,550 probably null Het
Elk3 G T 10: 93,250,044 P132Q probably damaging Het
Galt C T 4: 41,757,541 P238S probably damaging Het
Gm10322 T C 10: 59,616,262 V67A possibly damaging Het
Ice1 T C 13: 70,606,731 Y412C probably benign Het
Kcna1 A T 6: 126,642,323 Y345N probably damaging Het
Kif1b T C 4: 149,258,048 Y419C probably damaging Het
Klf15 G T 6: 90,466,619 A59S possibly damaging Het
Mettl17 T A 14: 51,888,779 Y162N probably damaging Het
Myh10 G A 11: 68,791,890 R1050Q probably damaging Het
Nemp1 T A 10: 127,689,450 probably null Het
Nlrp9a T C 7: 26,558,763 I602T possibly damaging Het
Nphp4 T C 4: 152,544,449 V764A probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr895 C T 9: 38,268,602 Q22* probably null Het
Osbp2 A T 11: 3,717,221 probably null Het
Pax2 A G 19: 44,790,740 Y185C probably damaging Het
Pdyn A T 2: 129,688,348 S134T possibly damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Ppp1r13l A G 7: 19,377,511 M754V probably benign Het
Prr23a3 T A 9: 98,865,678 N228K probably benign Het
Psmd12 T C 11: 107,491,907 F213L probably damaging Het
Qser1 A T 2: 104,789,283 S395T probably damaging Het
Rab7b A G 1: 131,698,634 probably null Het
Rev3l T A 10: 39,862,713 L2821* probably null Het
Rplp0 A G 5: 115,561,160 N127S probably benign Het
Serpina9 G T 12: 104,008,419 Y158* probably null Het
Sis G A 3: 72,961,027 T110M possibly damaging Het
Slc43a2 A G 11: 75,563,050 Y263C probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stard13 A T 5: 151,092,762 V88E probably damaging Het
Trim29 G A 9: 43,319,377 E286K probably damaging Het
Vmn2r24 T C 6: 123,787,246 S361P probably damaging Het
Wnk2 T C 13: 49,060,832 T18A probably damaging Het
Xylb C T 9: 119,381,591 T380M probably damaging Het
Zbtb5 T C 4: 44,994,119 T422A probably benign Het
Zhx2 A G 15: 57,823,206 E657G probably damaging Het
Other mutations in Nek4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Nek4 APN 14 30970262 missense probably benign 0.00
IGL01746:Nek4 APN 14 30977584 splice site probably null
IGL02403:Nek4 APN 14 30964051 nonsense probably null
IGL02606:Nek4 APN 14 30963959 missense probably benign 0.01
IGL03261:Nek4 APN 14 30975290 missense probably benign 0.05
R0266:Nek4 UTSW 14 30957296 missense probably damaging 1.00
R0436:Nek4 UTSW 14 30970472 missense probably damaging 0.96
R0520:Nek4 UTSW 14 30959306 splice site probably benign
R0523:Nek4 UTSW 14 30980038 missense probably benign 0.18
R0849:Nek4 UTSW 14 30957296 missense probably damaging 1.00
R1167:Nek4 UTSW 14 30974345 missense possibly damaging 0.68
R1465:Nek4 UTSW 14 30956887 missense probably damaging 1.00
R1465:Nek4 UTSW 14 30956887 missense probably damaging 1.00
R1484:Nek4 UTSW 14 30982333 missense possibly damaging 0.56
R1563:Nek4 UTSW 14 30982451 missense probably damaging 1.00
R1616:Nek4 UTSW 14 30987137 missense probably damaging 0.98
R1670:Nek4 UTSW 14 30982427 missense probably damaging 1.00
R1991:Nek4 UTSW 14 30956953 missense probably damaging 0.98
R2045:Nek4 UTSW 14 30953923 missense probably damaging 1.00
R2157:Nek4 UTSW 14 30979968 intron probably null
R2925:Nek4 UTSW 14 30951710 missense probably benign 0.29
R4342:Nek4 UTSW 14 30953906 missense probably damaging 1.00
R5964:Nek4 UTSW 14 30957079 critical splice donor site probably null
R6030:Nek4 UTSW 14 30956933 missense probably damaging 1.00
R6030:Nek4 UTSW 14 30956933 missense probably damaging 1.00
R7145:Nek4 UTSW 14 30982348 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGTCCCAAGAGAAACCAGTG -3'
(R):5'- TGTGTACCACTCACCTGGTCTG -3'

Sequencing Primer
(F):5'- TCCCAAGAGAAACCAGTGGACATTG -3'
(R):5'- TTGAGGGATACAATGGCTTCACC -3'
Posted On2017-10-10