Incidental Mutation 'R5614:Osbpl6'
ID490462
Institutional Source Beutler Lab
Gene Symbol Osbpl6
Ensembl Gene ENSMUSG00000042359
Gene Nameoxysterol binding protein-like 6
Synonyms1110062M20Rik, ORP-6
MMRRC Submission 043275-MU
Accession Numbers

Genbank: NM_145525; MGI: 2139014

Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location76406508-76600647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76568109 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 379 (V379E)
Ref Sequence ENSEMBL: ENSMUSP00000107561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077972] [ENSMUST00000111929] [ENSMUST00000111930] [ENSMUST00000184442]
Predicted Effect probably damaging
Transcript: ENSMUST00000077972
AA Change: V410E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077123
Gene: ENSMUSG00000042359
AA Change: V410E

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
low complexity region 537 550 N/A INTRINSIC
Pfam:Oxysterol_BP 603 951 1.4e-135 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111929
AA Change: V410E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107560
Gene: ENSMUSG00000042359
AA Change: V410E

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
coiled coil region 441 472 N/A INTRINSIC
low complexity region 529 542 N/A INTRINSIC
Pfam:Oxysterol_BP 595 944 1.1e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111930
AA Change: V379E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107561
Gene: ENSMUSG00000042359
AA Change: V379E

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
PH 87 183 3.65e-7 SMART
low complexity region 200 211 N/A INTRINSIC
coiled coil region 255 285 N/A INTRINSIC
coiled coil region 410 441 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:Oxysterol_BP 564 913 1e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124601
Predicted Effect probably damaging
Transcript: ENSMUST00000184442
AA Change: V272E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139363
Gene: ENSMUSG00000042359
AA Change: V272E

DomainStartEndE-ValueType
Blast:PH 1 70 8e-41 BLAST
low complexity region 87 98 N/A INTRINSIC
coiled coil region 142 172 N/A INTRINSIC
coiled coil region 303 334 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
Pfam:Oxysterol_BP 457 794 2.6e-135 PFAM
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

 

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Osbpl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Osbpl6 APN 2 76590439 missense probably damaging 1.00
IGL01109:Osbpl6 APN 2 76549527 missense probably damaging 1.00
IGL01288:Osbpl6 APN 2 76564823 missense probably damaging 0.98
IGL01717:Osbpl6 APN 2 76588594 missense probably damaging 1.00
IGL02146:Osbpl6 APN 2 76549750 missense possibly damaging 0.90
IGL02597:Osbpl6 APN 2 76555974 nonsense probably null
IGL02652:Osbpl6 APN 2 76593454 missense probably damaging 1.00
IGL02867:Osbpl6 APN 2 76595870 splice site probably benign
IGL03143:Osbpl6 APN 2 76548372 missense probably damaging 1.00
3-1:Osbpl6 UTSW 2 76586151 missense probably damaging 1.00
R0085:Osbpl6 UTSW 2 76593414 missense probably benign 0.30
R0201:Osbpl6 UTSW 2 76546042 missense possibly damaging 0.92
R0573:Osbpl6 UTSW 2 76590391 missense probably damaging 1.00
R0644:Osbpl6 UTSW 2 76594840 missense probably damaging 1.00
R0855:Osbpl6 UTSW 2 76585133 missense probably damaging 1.00
R0855:Osbpl6 UTSW 2 76591839 missense probably damaging 1.00
R1017:Osbpl6 UTSW 2 76549719 missense probably damaging 1.00
R1459:Osbpl6 UTSW 2 76555065 missense probably benign 0.01
R1505:Osbpl6 UTSW 2 76579242 missense probably damaging 1.00
R1588:Osbpl6 UTSW 2 76579216 missense probably benign
R1786:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R1863:Osbpl6 UTSW 2 76585058 missense probably damaging 1.00
R2131:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2132:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2133:Osbpl6 UTSW 2 76586214 missense probably damaging 1.00
R2233:Osbpl6 UTSW 2 76586769 missense probably damaging 0.99
R2235:Osbpl6 UTSW 2 76586769 missense probably damaging 0.99
R2256:Osbpl6 UTSW 2 76584474 missense probably damaging 1.00
R2294:Osbpl6 UTSW 2 76577079 missense possibly damaging 0.81
R3023:Osbpl6 UTSW 2 76586733 missense probably damaging 1.00
R4192:Osbpl6 UTSW 2 76585229 missense probably damaging 1.00
R4544:Osbpl6 UTSW 2 76584492 missense possibly damaging 0.84
R4546:Osbpl6 UTSW 2 76584492 missense possibly damaging 0.84
R4664:Osbpl6 UTSW 2 76568208 missense probably benign 0.02
R4764:Osbpl6 UTSW 2 76546000 missense probably damaging 1.00
R4884:Osbpl6 UTSW 2 76549539 missense probably damaging 1.00
R5080:Osbpl6 UTSW 2 76524085 missense probably benign 0.31
R5430:Osbpl6 UTSW 2 76586138 missense probably damaging 1.00
R5807:Osbpl6 UTSW 2 76584513 missense probably damaging 0.98
R5956:Osbpl6 UTSW 2 76549512 missense probably damaging 1.00
R6394:Osbpl6 UTSW 2 76555954 missense probably benign 0.00
R6430:Osbpl6 UTSW 2 76579276 missense probably damaging 1.00
R6450:Osbpl6 UTSW 2 76564830 missense possibly damaging 0.90
R7116:Osbpl6 UTSW 2 76595881 missense probably benign 0.06
R7385:Osbpl6 UTSW 2 76549450 missense probably damaging 1.00
Z31818:Osbpl6 UTSW 2 76555082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAACTGTGTTGGCTCAGC -3'
(R):5'- TTGTTGGCCATGCATACAAAAC -3'

Sequencing Primer
(F):5'- GGCTCAGCTGGTATGAAATATAAC -3'
(R):5'- TGCATACAAAACCGCTTGGG -3'
Posted On2017-10-11