Incidental Mutation 'R5614:Clspn'
ID490464
Institutional Source Beutler Lab
Gene Symbol Clspn
Ensembl Gene ENSMUSG00000042489
Gene Nameclaspin
SynonymsC85083, E130314M08Rik
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126556935-126593903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126580962 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 968 (E968G)
Ref Sequence ENSEMBL: ENSMUSP00000045344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048391]
Predicted Effect probably damaging
Transcript: ENSMUST00000048391
AA Change: E968G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: E968G

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
coiled coil region 159 187 N/A INTRINSIC
low complexity region 214 230 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 477 490 N/A INTRINSIC
coiled coil region 599 626 N/A INTRINSIC
low complexity region 632 658 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 732 753 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 968 975 N/A INTRINSIC
coiled coil region 1001 1036 N/A INTRINSIC
low complexity region 1045 1064 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121439
Predicted Effect probably benign
Transcript: ENSMUST00000126512
SMART Domains Protein: ENSMUSP00000119437
Gene: ENSMUSG00000042489

DomainStartEndE-ValueType
coiled coil region 74 101 N/A INTRINSIC
low complexity region 108 147 N/A INTRINSIC
low complexity region 153 170 N/A INTRINSIC
low complexity region 221 242 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128202
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Nxpe2 A T 9: 48,323,101 F289I probably benign Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Clspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Clspn APN 4 126573178 missense probably damaging 1.00
IGL02160:Clspn APN 4 126581510 missense probably benign 0.21
IGL02231:Clspn APN 4 126559228 missense probably damaging 0.98
IGL02281:Clspn APN 4 126565770 missense possibly damaging 0.90
IGL02368:Clspn APN 4 126566107 missense probably benign
IGL03149:Clspn APN 4 126576502 splice site probably benign
Durch UTSW 4 126580962 missense probably damaging 0.99
R0012:Clspn UTSW 4 126564929 unclassified probably benign
R0035:Clspn UTSW 4 126565003 unclassified probably null
R0035:Clspn UTSW 4 126565003 unclassified probably null
R0207:Clspn UTSW 4 126590598 missense possibly damaging 0.82
R0270:Clspn UTSW 4 126573236 missense probably damaging 1.00
R0825:Clspn UTSW 4 126573130 splice site probably benign
R1082:Clspn UTSW 4 126577779 missense possibly damaging 0.95
R1349:Clspn UTSW 4 126563977 missense probably benign
R1568:Clspn UTSW 4 126581517 missense probably benign 0.01
R1649:Clspn UTSW 4 126566435 unclassified probably benign
R1663:Clspn UTSW 4 126565975 missense probably benign 0.00
R2497:Clspn UTSW 4 126572347 missense possibly damaging 0.79
R3107:Clspn UTSW 4 126591659 missense probably benign 0.06
R3951:Clspn UTSW 4 126576379 missense probably damaging 1.00
R3953:Clspn UTSW 4 126566437 frame shift probably null
R3954:Clspn UTSW 4 126566437 frame shift probably null
R3956:Clspn UTSW 4 126566437 frame shift probably null
R4599:Clspn UTSW 4 126581460 missense probably benign 0.14
R4717:Clspn UTSW 4 126560056 missense probably damaging 1.00
R4853:Clspn UTSW 4 126566555 missense probably damaging 0.99
R4854:Clspn UTSW 4 126575950 missense probably benign
R4979:Clspn UTSW 4 126578386 missense probably damaging 1.00
R5363:Clspn UTSW 4 126561786 missense possibly damaging 0.58
R5531:Clspn UTSW 4 126577773 missense probably benign
R5706:Clspn UTSW 4 126578418 missense probably damaging 1.00
R5806:Clspn UTSW 4 126586106 missense probably damaging 1.00
R6106:Clspn UTSW 4 126590641 missense probably benign 0.00
R6178:Clspn UTSW 4 126577736 synonymous probably null
R6223:Clspn UTSW 4 126586168 missense probably damaging 0.99
R6326:Clspn UTSW 4 126565739 missense probably damaging 1.00
R6398:Clspn UTSW 4 126563947 missense probably damaging 1.00
R6714:Clspn UTSW 4 126565768 missense probably damaging 1.00
R7003:Clspn UTSW 4 126592720 missense possibly damaging 0.63
R7034:Clspn UTSW 4 126580982 missense possibly damaging 0.87
T0975:Clspn UTSW 4 126566437 unclassified probably benign
X0014:Clspn UTSW 4 126575943 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAAGGACTTCGGAGGTTG -3'
(R):5'- CAGGACACTGCTTCTGGTAAG -3'

Sequencing Primer
(F):5'- ACTCCAGTTTTCACAGTAGCAGGG -3'
(R):5'- GGTAAGACGCTAAGCTCAGTTCTC -3'
Posted On2017-10-11