Incidental Mutation 'R5614:Nxpe2'
ID490465
Institutional Source Beutler Lab
Gene Symbol Nxpe2
Ensembl Gene ENSMUSG00000032028
Gene Nameneurexophilin and PC-esterase domain family, member 2
Synonyms
MMRRC Submission 043275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5614 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location48318006-48353454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48323101 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 289 (F289I)
Ref Sequence ENSEMBL: ENSMUSP00000034527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034527] [ENSMUST00000135457] [ENSMUST00000137976] [ENSMUST00000215780] [ENSMUST00000216998]
Predicted Effect probably benign
Transcript: ENSMUST00000034527
AA Change: F289I

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034527
Gene: ENSMUSG00000032028
AA Change: F289I

DomainStartEndE-ValueType
transmembrane domain 22 39 N/A INTRINSIC
Pfam:Neurexophilin 80 277 1.2e-18 PFAM
low complexity region 307 316 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135457
AA Change: V45D
Predicted Effect probably benign
Transcript: ENSMUST00000137976
SMART Domains Protein: ENSMUSP00000116684
Gene: ENSMUSG00000032028

DomainStartEndE-ValueType
transmembrane domain 22 39 N/A INTRINSIC
Pfam:Neurexophilin 99 187 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215780
Predicted Effect probably benign
Transcript: ENSMUST00000216998
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik G A 5: 24,550,142 A330V probably benign Het
Abca1 A G 4: 53,046,132 V1712A probably damaging Het
Ankmy2 T C 12: 36,193,784 S333P probably damaging Het
Arfrp1 A G 2: 181,359,443 probably benign Het
Atp13a2 A G 4: 140,992,182 T21A probably benign Het
Bud23 C A 5: 135,059,112 A152S probably benign Het
Cant1 T C 11: 118,408,743 D260G probably benign Het
Ces1b T C 8: 93,068,208 I254M probably benign Het
Ces1d T C 8: 93,176,204 T375A probably benign Het
Cfap54 A G 10: 93,045,049 L384P probably damaging Het
Chrne C T 11: 70,615,053 V469I possibly damaging Het
Clspn A G 4: 126,580,962 E968G probably damaging Het
Col5a3 A G 9: 20,783,476 probably benign Het
Dtx4 T C 19: 12,482,183 Y419C probably damaging Het
Fam171b T A 2: 83,812,873 I42N probably damaging Het
Fam43a T C 16: 30,601,672 I358T possibly damaging Het
Fasn T C 11: 120,813,328 S1422G probably benign Het
Fig4 A T 10: 41,272,985 V157E probably damaging Het
Fus T C 7: 127,974,371 probably benign Het
Hmcn2 G T 2: 31,428,303 V3887F probably damaging Het
Hmgcll1 A G 9: 76,081,393 Y182C probably damaging Het
Hook2 T A 8: 85,002,508 I585N probably damaging Het
Iars2 T C 1: 185,289,508 T866A probably benign Het
Lrit1 T A 14: 37,061,954 M413K probably benign Het
Myl9 G A 2: 156,781,163 probably benign Het
Nelfa A T 5: 33,920,500 L179Q probably damaging Het
Nod2 A T 8: 88,664,196 D355V probably damaging Het
Npbwr1 A T 1: 5,916,811 S161R probably damaging Het
Odf2 A G 2: 29,920,867 I538M probably damaging Het
Osbpl6 T A 2: 76,568,109 V379E probably damaging Het
Pkhd1 A G 1: 20,073,526 C3859R possibly damaging Het
Rgs1 G T 1: 144,246,257 T99N probably benign Het
Rnf6 T C 5: 146,218,100 probably null Het
Rtp1 C A 16: 23,431,190 Q102K possibly damaging Het
Sec24c T A 14: 20,682,738 V123E possibly damaging Het
Serpini2 T C 3: 75,257,707 probably benign Het
Stxbp5 A T 10: 9,760,894 probably benign Het
Tecta A G 9: 42,339,055 S1809P probably damaging Het
Tgfb2 T A 1: 186,625,513 I394F probably benign Het
Thg1l T C 11: 45,950,227 Y175C possibly damaging Het
Tmem67 C A 4: 12,061,755 K572N possibly damaging Het
Tollip T C 7: 141,892,088 T19A probably damaging Het
Ttn A G 2: 76,712,107 Y25185H probably damaging Het
Vgll2 A T 10: 52,025,222 R83* probably null Het
Wfdc8 G T 2: 164,603,203 A164E probably damaging Het
Ylpm1 T C 12: 85,064,944 probably benign Het
Zfp326 T A 5: 105,888,495 S91T probably damaging Het
Zfp638 T C 6: 83,929,641 F263L probably damaging Het
Zfp800 G A 6: 28,243,136 T610I probably damaging Het
Zmym4 A G 4: 126,910,936 F475L possibly damaging Het
Other mutations in Nxpe2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Nxpe2 APN 9 48320623 missense probably benign 0.00
IGL01830:Nxpe2 APN 9 48326494 missense probably damaging 1.00
IGL02039:Nxpe2 APN 9 48319659 missense probably benign 0.11
IGL02618:Nxpe2 APN 9 48326334 missense probably damaging 1.00
IGL03065:Nxpe2 APN 9 48319692 missense possibly damaging 0.68
IGL03128:Nxpe2 APN 9 48319498 missense probably benign 0.12
P4717OSA:Nxpe2 UTSW 9 48326377 missense probably benign 0.08
R0019:Nxpe2 UTSW 9 48319780 missense probably benign 0.37
R0172:Nxpe2 UTSW 9 48319909 missense possibly damaging 0.76
R0255:Nxpe2 UTSW 9 48340570 critical splice donor site probably null
R0415:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1061:Nxpe2 UTSW 9 48326363 missense probably damaging 1.00
R1248:Nxpe2 UTSW 9 48319911 missense possibly damaging 0.46
R1311:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1393:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1827:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1828:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1831:Nxpe2 UTSW 9 48326152 missense probably benign 0.01
R1866:Nxpe2 UTSW 9 48326821 missense probably benign 0.01
R1889:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1892:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1903:Nxpe2 UTSW 9 48319606 missense probably benign 0.40
R1928:Nxpe2 UTSW 9 48326614 missense probably damaging 0.99
R1959:Nxpe2 UTSW 9 48319726 missense probably benign 0.06
R4594:Nxpe2 UTSW 9 48319482 missense probably damaging 1.00
R4697:Nxpe2 UTSW 9 48320521 missense probably benign 0.03
R4909:Nxpe2 UTSW 9 48319597 missense possibly damaging 0.93
R5048:Nxpe2 UTSW 9 48326088 splice site probably null
R5372:Nxpe2 UTSW 9 48339519 missense possibly damaging 0.66
R5762:Nxpe2 UTSW 9 48319575 missense probably benign 0.02
R6151:Nxpe2 UTSW 9 48326191 missense probably benign 0.01
R6958:Nxpe2 UTSW 9 48326266 missense probably damaging 1.00
R7130:Nxpe2 UTSW 9 48339537 missense probably benign 0.00
R7138:Nxpe2 UTSW 9 48320706 missense probably damaging 1.00
R7250:Nxpe2 UTSW 9 48326796 missense possibly damaging 0.77
R7289:Nxpe2 UTSW 9 48323039 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGGGTATCTCATTTGTCCCAG -3'
(R):5'- ATACATGGCACCCTGGATTTCC -3'

Sequencing Primer
(F):5'- CATTTGTCCCAGAAAATAAGAGCTC -3'
(R):5'- AGATTCCCCCATCATATGTAGGG -3'
Posted On2017-10-11