Incidental Mutation 'R5862:Tyms'
ID490482
Institutional Source Beutler Lab
Gene Symbol Tyms
Ensembl Gene ENSMUSG00000025747
Gene Namethymidylate synthase
SynonymsTS
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30058202-30073617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30063410 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 97 (D97E)
Ref Sequence ENSEMBL: ENSMUSP00000142970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026846] [ENSMUST00000141630] [ENSMUST00000146520] [ENSMUST00000196095] [ENSMUST00000196872] [ENSMUST00000198095]
Predicted Effect probably benign
Transcript: ENSMUST00000026846
AA Change: D180E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000026846
Gene: ENSMUSG00000025747
AA Change: D180E

DomainStartEndE-ValueType
Pfam:Thymidylat_synt 25 307 2.4e-118 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138520
Predicted Effect probably benign
Transcript: ENSMUST00000141630
SMART Domains Protein: ENSMUSP00000123377
Gene: ENSMUSG00000025747

DomainStartEndE-ValueType
Pfam:Thymidylat_synt 24 121 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154751
Predicted Effect probably benign
Transcript: ENSMUST00000196095
SMART Domains Protein: ENSMUSP00000143552
Gene: ENSMUSG00000025747

DomainStartEndE-ValueType
Pfam:Thymidylat_synt 25 93 1.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196872
AA Change: D97E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142970
Gene: ENSMUSG00000025747
AA Change: D97E

DomainStartEndE-ValueType
Pfam:Thymidylat_synt 24 65 4.3e-6 PFAM
Pfam:Thymidylat_synt 59 175 6.8e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198095
SMART Domains Protein: ENSMUSP00000143001
Gene: ENSMUSG00000025747

DomainStartEndE-ValueType
Pfam:Thymidylat_synt 24 88 6.6e-20 PFAM
Pfam:Thymidylat_synt 86 139 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that catalyzes the methylation of deoxyuridylate to deoxythymidylate using 5,10-methylenetetrahydrofolate as a cofactor. This function maintains the thymidine-5-prime monophosphate concentration critical for DNA replication and repair. The encoded enzyme is a target for cancer chemotherapeutic agents. The majority of transcripts for this gene lack a 3' UTR (PMID: 3022294, 3444407). The stop codon in these transcripts is UAA, compared to the UAG found in the genome and longer transcripts, as the polyA site is located within the stop codon (PMID: 3444407, 2157203). A related pseudogene has been identified on chromosome 10. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Tyms
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02590:Tyms APN 5 30064151 missense probably benign 0.32
IGL02986:Tyms APN 5 30061999 missense probably damaging 1.00
R0225:Tyms UTSW 5 30063258 missense probably damaging 1.00
R1827:Tyms UTSW 5 30062016 synonymous probably null
R5933:Tyms UTSW 5 30073359 critical splice donor site probably null
R6799:Tyms UTSW 5 30061071 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCTAACTATGCCTTCCGAAAG -3'
(R):5'- ATGGGAGAGCATTGCTTCAG -3'

Sequencing Primer
(F):5'- GAAACTCACCTGCAGGCCTG -3'
(R):5'- GCTTCAGCATAAGTGTATACTTGCAG -3'
Posted On2017-10-20