Incidental Mutation 'R5851:Myo1e'
ID490504
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
MMRRC Submission 044067-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5851 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70383804 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 959 (G959E)
Ref Sequence ENSEMBL: ENSMUSP00000034745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
PDB Structure
MYOSIN 1E SH3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034745
AA Change: G959E

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: G959E

DomainStartEndE-ValueType
MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214042
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930404N11Rik A T 10: 81,364,877 probably null Het
Abca2 A G 2: 25,442,310 N1452D possibly damaging Het
Abhd15 T C 11: 77,518,447 L329P probably benign Het
Add3 T C 19: 53,236,774 S442P probably damaging Het
Arhgef18 T C 8: 3,434,980 F228L probably damaging Het
Bptf A T 11: 107,110,862 Y475N probably damaging Het
C3 T C 17: 57,211,612 N1257S probably null Het
Ccdc94 C T 17: 55,967,582 S298F probably damaging Het
Cd163l1 C T 7: 140,228,027 P704S possibly damaging Het
Cdkl1 A T 12: 69,756,564 Y179* probably null Het
Ceacam1 T C 7: 25,474,600 N210S possibly damaging Het
Celf3 T A 3: 94,479,126 I7N probably damaging Het
Cmpk1 A G 4: 114,986,970 V55A possibly damaging Het
Csrnp1 C T 9: 119,973,078 G305D possibly damaging Het
Dnah3 A G 7: 120,039,362 S1266P possibly damaging Het
Edc4 T C 8: 105,890,867 L1077P probably damaging Het
Efcab1 T A 16: 14,920,436 L155H probably damaging Het
Fam174a G A 1: 95,325,143 G157S probably damaging Het
Fubp3 T A 2: 31,598,610 D159E probably benign Het
Garem2 C T 5: 30,114,290 T250M probably damaging Het
H2-Eb1 C T 17: 34,309,771 P92L probably benign Het
Ifnl3 G T 7: 28,523,511 C69F probably damaging Het
Itga2b C A 11: 102,457,601 probably benign Het
Klhl33 A T 14: 50,892,878 D386E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lor G A 3: 92,080,539 A480V unknown Het
Msh3 G T 13: 92,215,522 Q1041K probably benign Het
Nfat5 G T 8: 107,347,727 V338L probably damaging Het
Nrf1 A G 6: 30,089,976 H18R possibly damaging Het
Nup160 A G 2: 90,707,038 D752G probably benign Het
Obscn A T 11: 58,994,700 L2489* probably null Het
Olfr1184 A G 2: 88,486,860 I43V possibly damaging Het
Olfr638 A G 7: 104,003,452 E59G probably benign Het
Paip1 T C 13: 119,440,765 S215P possibly damaging Het
Pate2 T A 9: 35,670,501 Y26* probably null Het
Pcdhb10 A G 18: 37,412,758 I296V probably benign Het
Pdzph1 T G 17: 58,973,746 T514P probably benign Het
Pnlip G A 19: 58,673,792 W123* probably null Het
Prmt2 C A 10: 76,236,740 C9F possibly damaging Het
Rbl1 T A 2: 157,167,325 K763N probably benign Het
Rfk C T 19: 17,395,198 A28V probably damaging Het
Sdk1 G A 5: 141,962,669 V590I probably benign Het
Sele A G 1: 164,049,574 K140E probably benign Het
Skiv2l2 G A 13: 112,908,952 R349W probably damaging Het
Sla G A 15: 66,783,723 T189I probably damaging Het
Slc46a2 A G 4: 59,913,906 V339A probably damaging Het
Slc5a9 A G 4: 111,885,600 F432L probably benign Het
Slc6a19 A G 13: 73,691,740 F141S possibly damaging Het
Tas2r123 T C 6: 132,847,308 L56S probably damaging Het
Tmem245 T C 4: 56,916,770 I53V probably benign Het
Tor2a A T 2: 32,761,607 Q278L probably benign Het
Trav6-3 A G 14: 53,430,115 M15V probably benign Het
Ttc28 G A 5: 111,235,469 probably benign Het
Ubap2 G A 4: 41,206,268 Q534* probably null Het
Zfp954 C A 7: 7,115,625 E307* probably null Het
Zscan21 A G 5: 138,126,478 K219E probably benign Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R0656:Myo1e UTSW 9 70367674 missense probably damaging 1.00
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1278:Myo1e UTSW 9 70398785 missense probably damaging 1.00
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1349:Myo1e UTSW 9 70287069 splice site probably benign
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1656:Myo1e UTSW 9 70395934 missense probably damaging 1.00
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R1970:Myo1e UTSW 9 70368773 missense probably benign 0.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4911:Myo1e UTSW 9 70343096 missense probably benign
R4995:Myo1e UTSW 9 70353272 missense probably benign 0.01
R4999:Myo1e UTSW 9 70353312 missense probably damaging 1.00
R5228:Myo1e UTSW 9 70322358 intron probably null
R5414:Myo1e UTSW 9 70322358 intron probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R6907:Myo1e UTSW 9 70327155 missense probably benign
R7084:Myo1e UTSW 9 70337801 missense probably damaging 0.96
R7313:Myo1e UTSW 9 70359385 critical splice donor site probably null
R7383:Myo1e UTSW 9 70297295 missense probably damaging 1.00
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCTATTACGTTGTTGTCCCCAAG -3'
(R):5'- GGACCTTGAGGAAATCCAGG -3'

Sequencing Primer
(F):5'- AACAGTTATACCTCAGTAGTGTTGGG -3'
(R):5'- CTTGAGGAAATCCAGGCTCTCTG -3'
Posted On2017-10-20