Incidental Mutation 'R5859:Nod1'
ID490513
Institutional Source Beutler Lab
Gene Symbol Nod1
Ensembl Gene ENSMUSG00000038058
Gene Namenucleotide-binding oligomerization domain containing 1
SynonymsCard4, F830007N14Rik, Nlrc1
MMRRC Submission 044071-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5859 (G1)
Quality Score181
Status Validated
Chromosome6
Chromosomal Location54923949-54972612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54930177 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 902 (W902R)
Ref Sequence ENSEMBL: ENSMUSP00000130487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060655] [ENSMUST00000168172] [ENSMUST00000203076]
Predicted Effect probably benign
Transcript: ENSMUST00000060655
AA Change: W902R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055747
Gene: ENSMUSG00000038058
AA Change: W902R

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:CARD 20 105 4.7e-21 PFAM
low complexity region 174 185 N/A INTRINSIC
Pfam:NACHT 196 368 1.3e-41 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 708 717 N/A INTRINSIC
LRR 727 754 1.25e0 SMART
LRR 755 782 1.22e1 SMART
LRR 783 810 1.96e2 SMART
LRR 811 838 1.08e-1 SMART
LRR 839 866 3.95e-4 SMART
LRR 867 894 1.51e0 SMART
LRR 895 922 7.15e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168172
AA Change: W902R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130487
Gene: ENSMUSG00000038058
AA Change: W902R

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:CARD 20 105 7.6e-20 PFAM
low complexity region 174 185 N/A INTRINSIC
Pfam:NACHT 196 368 6.2e-41 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 708 717 N/A INTRINSIC
LRR 727 754 1.25e0 SMART
LRR 755 782 1.22e1 SMART
LRR 783 810 1.96e2 SMART
LRR 811 838 1.08e-1 SMART
LRR 839 866 3.95e-4 SMART
LRR 867 894 1.51e0 SMART
LRR 895 922 7.15e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203076
AA Change: W248R

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000145123
Gene: ENSMUSG00000038058
AA Change: W248R

DomainStartEndE-ValueType
low complexity region 82 91 N/A INTRINSIC
LRR 101 128 5.3e-3 SMART
LRR 157 184 4.8e-4 SMART
LRR 185 212 1.7e-6 SMART
LRR 213 240 6.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203916
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOD (nucleotide-binding oligomerization domain) family. This member is a cytosolic protein. It contains an N-terminal caspase recruitment domain (CARD), a centrally located nucleotide-binding domain (NBD), and 10 tandem leucine-rich repeats (LRRs) in its C terminus. The CARD is involved in apoptotic signaling, LRRs participate in protein-protein interactions, and mutations in the NBD may affect the process of oligomerization and subsequent function of the LRR domain. This protein is an intracellular pattern-recognition receptor (PRR) that initiates inflammation in response to a subset of bacteria through the detection of bacterial diaminopimelic acid. Multiple alternatively spliced transcript variants differring in the 5' UTR have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice were viable, fertile, and appeared normal in a specific-pathogen free environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A T 8: 24,813,461 V150E probably benign Het
Alg11 A G 8: 22,065,841 K373E probably benign Het
Arl14ep C T 2: 106,969,053 probably benign Het
Ascc2 G A 11: 4,658,284 G227R probably benign Het
Ash1l C T 3: 89,068,993 P2627S probably damaging Het
Btla T G 16: 45,239,039 probably null Het
Btnl10 C T 11: 58,922,312 P256S probably benign Het
Cep162 C T 9: 87,204,092 A1060T probably damaging Het
Cfap54 T A 10: 93,016,524 K907* probably null Het
Chpf A T 1: 75,475,428 F461I probably damaging Het
Chrdl2 A G 7: 100,020,907 Y79C probably damaging Het
Copb2 G A 9: 98,568,108 C40Y probably benign Het
Cyfip1 T C 7: 55,925,181 L1060P probably damaging Het
Drg1 G A 11: 3,259,273 probably benign Het
Erich3 A G 3: 154,762,497 D862G possibly damaging Het
Flii G T 11: 60,716,311 Y946* probably null Het
Glt8d2 T C 10: 82,672,081 M1V probably null Het
Gm21136 T A 7: 38,867,741 noncoding transcript Het
Gramd1c T C 16: 43,992,091 T393A possibly damaging Het
Gucy2d T A 7: 98,451,883 I471N probably benign Het
Hps3 G A 3: 20,008,870 T711M probably benign Het
Hs3st4 A T 7: 123,983,608 D143V probably benign Het
Kif17 T A 4: 138,291,433 M461K possibly damaging Het
Klhdc7a T A 4: 139,967,574 S21C probably damaging Het
Klk15 G A 7: 43,938,376 R76H probably benign Het
Lnpk G A 2: 74,569,028 T57I possibly damaging Het
Ltbp2 A G 12: 84,794,063 V999A possibly damaging Het
Ltbr T C 6: 125,312,808 H141R probably damaging Het
Lvrn T C 18: 46,893,749 F805L probably damaging Het
Ms4a13 A T 19: 11,183,916 C86* probably null Het
Ncbp1 A G 4: 46,163,026 N480S probably benign Het
Nelfcd T G 2: 174,427,063 *592G probably null Het
Neurog2 T C 3: 127,634,015 V96A probably benign Het
Olfr103 T C 17: 37,336,369 I288V possibly damaging Het
Olfr213 T C 6: 116,540,900 L149P probably damaging Het
Olfr543 T C 7: 102,477,750 Y40C possibly damaging Het
Olfr726 T A 14: 50,084,027 Y218F probably damaging Het
Pcdha11 A T 18: 37,007,283 H655L probably damaging Het
Plpp7 A G 2: 32,095,984 E58G probably benign Het
Psph A T 5: 129,790,621 probably benign Het
Rab11fip1 A C 8: 27,154,720 S346A probably damaging Het
Rreb1 C A 13: 37,947,408 P1513T probably benign Het
Rreb1 C T 13: 37,947,409 P1513L probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Scap A G 9: 110,374,047 N263S probably benign Het
Sec24d A T 3: 123,279,312 probably benign Het
Slain2 T C 5: 72,948,545 probably benign Het
Slc6a18 G T 13: 73,668,159 T367N probably benign Het
Slk T A 19: 47,609,042 D96E probably benign Het
Spag5 G A 11: 78,313,534 V514I probably benign Het
St8sia2 T C 7: 73,966,906 D107G probably damaging Het
Tgfbr3 T A 5: 107,140,515 I427F probably benign Het
Tlr2 T G 3: 83,836,503 T758P possibly damaging Het
Tmem270 A G 5: 134,902,884 V68A probably benign Het
Vmn2r106 T A 17: 20,285,321 H37L possibly damaging Het
Vmn2r27 T G 6: 124,200,688 R452S probably damaging Het
Wdr5 A G 2: 27,533,350 Y252C probably damaging Het
Zswim9 C T 7: 13,261,445 V262M probably damaging Het
Other mutations in Nod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Nod1 APN 6 54944946 missense probably damaging 1.00
IGL00937:Nod1 APN 6 54937364 missense probably benign 0.08
IGL00945:Nod1 APN 6 54944586 unclassified probably null
IGL01410:Nod1 APN 6 54944356 missense probably damaging 1.00
IGL02094:Nod1 APN 6 54939390 splice site probably null
IGL02217:Nod1 APN 6 54943419 missense possibly damaging 0.63
IGL02573:Nod1 APN 6 54943945 missense probably benign 0.02
IGL02944:Nod1 APN 6 54924947 missense possibly damaging 0.68
R0092:Nod1 UTSW 6 54944541 missense probably damaging 1.00
R0108:Nod1 UTSW 6 54943749 missense probably benign 0.27
R0148:Nod1 UTSW 6 54938217 missense probably damaging 1.00
R0771:Nod1 UTSW 6 54944269 missense probably damaging 0.96
R1493:Nod1 UTSW 6 54944056 missense probably damaging 1.00
R1540:Nod1 UTSW 6 54943975 missense probably benign 0.09
R1660:Nod1 UTSW 6 54944233 unclassified probably null
R1710:Nod1 UTSW 6 54944059 missense probably damaging 0.98
R1911:Nod1 UTSW 6 54944440 missense probably damaging 0.96
R2008:Nod1 UTSW 6 54939325 missense probably damaging 1.00
R3409:Nod1 UTSW 6 54944917 missense probably benign 0.01
R3410:Nod1 UTSW 6 54944917 missense probably benign 0.01
R3927:Nod1 UTSW 6 54944917 missense probably benign 0.01
R4499:Nod1 UTSW 6 54943996 missense probably damaging 1.00
R4608:Nod1 UTSW 6 54943756 missense probably damaging 1.00
R5552:Nod1 UTSW 6 54944631 missense probably damaging 1.00
R5667:Nod1 UTSW 6 54933576 missense probably benign 0.06
R5868:Nod1 UTSW 6 54939327 missense probably damaging 1.00
R5995:Nod1 UTSW 6 54944554 missense probably damaging 0.99
R6329:Nod1 UTSW 6 54944704 missense probably benign 0.00
R6331:Nod1 UTSW 6 54924983 missense probably damaging 1.00
R6642:Nod1 UTSW 6 54948029 missense probably damaging 1.00
R6798:Nod1 UTSW 6 54944611 missense probably damaging 0.97
R6889:Nod1 UTSW 6 54944109 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GAGATGGCAGGACAGAACCT -3'
(R):5'- CAGGATTCAGAGTAGCCTGG -3'

Sequencing Primer
(F):5'- CCTGGGGGAAGGGCAGTAAAC -3'
(R):5'- ATTCAGAGTAGCCTGGGAGCC -3'
Posted On2017-10-20