Incidental Mutation 'R5876:Grid2'
ID 490528
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Name glutamate receptor, ionotropic, delta 2
Synonyms tpr, B230104L07Rik, GluRdelta2
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5876 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 63232860-64681307 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64640146 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 788 (I788N)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852] [ENSMUST00000210324]
AlphaFold Q61625
Predicted Effect probably damaging
Transcript: ENSMUST00000095852
AA Change: I788N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: I788N

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210324
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,796,654 (GRCm39) D64G possibly damaging Het
Ano2 T A 6: 126,016,242 (GRCm39) M925K possibly damaging Het
Arnt2 T C 7: 83,996,720 (GRCm39) T69A probably damaging Het
Asap2 T A 12: 21,262,810 (GRCm39) N229K possibly damaging Het
Atp13a3 T A 16: 30,181,552 (GRCm39) N23Y probably benign Het
Cbr4 G A 8: 61,943,627 (GRCm39) G91R possibly damaging Het
Cdc27 A T 11: 104,406,244 (GRCm39) C624S probably benign Het
Cdc42bpg T A 19: 6,360,845 (GRCm39) I201N probably damaging Het
Cdh5 A G 8: 104,869,209 (GRCm39) Y645C probably damaging Het
Celsr2 C T 3: 108,321,259 (GRCm39) V518I probably damaging Het
Clca4b T C 3: 144,617,821 (GRCm39) T761A possibly damaging Het
Cpne4 C A 9: 104,802,969 (GRCm39) S204R probably damaging Het
Dcaf1 T C 9: 106,740,849 (GRCm39) W1279R probably damaging Het
Dennd4a C T 9: 64,819,037 (GRCm39) P1731S probably damaging Het
Dmxl1 T A 18: 50,004,051 (GRCm39) V892D possibly damaging Het
Fam131b A G 6: 42,298,182 (GRCm39) probably null Het
Fam83b T A 9: 76,399,132 (GRCm39) D657V possibly damaging Het
Fam83e T A 7: 45,371,787 (GRCm39) probably null Het
Fbxo4 A T 15: 4,007,301 (GRCm39) I121N probably damaging Het
Gabrg2 A G 11: 41,859,647 (GRCm39) S202P probably damaging Het
Grik4 T A 9: 42,599,319 (GRCm39) N53Y probably damaging Het
Hipk2 A C 6: 38,707,802 (GRCm39) probably null Het
Hps5 T C 7: 46,438,620 (GRCm39) T38A probably damaging Het
Hs1bp3 A G 12: 8,391,843 (GRCm39) D315G possibly damaging Het
Kdm4a C T 4: 117,996,073 (GRCm39) M985I probably damaging Het
Kdm5d A G Y: 900,525 (GRCm39) Y190C probably damaging Het
Krt86 T C 15: 101,374,491 (GRCm39) S295P probably damaging Het
Matr3 T A 18: 35,720,791 (GRCm39) D413E probably benign Het
Mbd5 T A 2: 49,164,657 (GRCm39) F319L probably damaging Het
Mcoln1 T A 8: 3,560,910 (GRCm39) Y411N probably damaging Het
Mpdz C A 4: 81,203,711 (GRCm39) E1863* probably null Het
Mrps9 A G 1: 42,934,538 (GRCm39) E173G probably damaging Het
Or7a42 A T 10: 78,791,191 (GRCm39) I51F probably benign Het
Osmr T C 15: 6,850,528 (GRCm39) T692A probably benign Het
Pkhd1l1 A T 15: 44,441,984 (GRCm39) H3641L possibly damaging Het
Pml T C 9: 58,140,465 (GRCm39) T421A possibly damaging Het
Podxl A G 6: 31,505,391 (GRCm39) probably null Het
Ppargc1b C G 18: 61,442,164 (GRCm39) D591H probably damaging Het
Prkag3 A G 1: 74,787,975 (GRCm39) probably benign Het
Proz A G 8: 13,123,448 (GRCm39) R240G probably benign Het
Ptpn13 C A 5: 103,624,826 (GRCm39) D43E probably damaging Het
Rbm5 T G 9: 107,637,525 (GRCm39) K135N probably damaging Het
Ska1 G A 18: 74,330,599 (GRCm39) T201M probably damaging Het
Slc35f5 A C 1: 125,515,100 (GRCm39) probably null Het
Slc9a3 T C 13: 74,309,842 (GRCm39) L510P probably damaging Het
Speer4a2 T C 5: 26,289,716 (GRCm39) E237G probably damaging Het
Svil A G 18: 5,082,828 (GRCm39) K1231E probably damaging Het
Tanc2 T C 11: 105,813,439 (GRCm39) S1628P possibly damaging Het
Tm9sf3 T A 19: 41,229,023 (GRCm39) D260V probably damaging Het
Ttc9 G T 12: 81,678,396 (GRCm39) R73L probably damaging Het
Vps13b A G 15: 35,917,207 (GRCm39) I3684V probably damaging Het
Vps8 T C 16: 21,280,189 (GRCm39) probably null Het
Vwa3b T A 1: 37,115,520 (GRCm39) I328N probably damaging Het
Wdr1 C T 5: 38,687,366 (GRCm39) V222M probably benign Het
Xpnpep1 T A 19: 52,985,439 (GRCm39) T530S probably damaging Het
Zc3h6 C T 2: 128,835,197 (GRCm39) S111F probably benign Het
Zfp768 G A 7: 126,943,718 (GRCm39) P137S probably benign Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64,322,573 (GRCm39) missense probably damaging 1.00
IGL00596:Grid2 APN 6 64,510,688 (GRCm39) missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64,297,180 (GRCm39) missense probably benign 0.00
IGL01712:Grid2 APN 6 64,642,899 (GRCm39) missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64,040,919 (GRCm39) missense probably benign 0.29
IGL02216:Grid2 APN 6 64,322,650 (GRCm39) missense probably damaging 0.96
IGL02563:Grid2 APN 6 64,322,857 (GRCm39) missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64,322,800 (GRCm39) missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64,040,888 (GRCm39) missense probably damaging 0.98
IGL03324:Grid2 APN 6 64,406,806 (GRCm39) missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63,886,053 (GRCm39) missense possibly damaging 0.94
crawler UTSW 6 64,406,678 (GRCm39) nonsense probably null
swagger UTSW 6 64,372,263 (GRCm39) synonymous probably benign
R0133:Grid2 UTSW 6 64,297,116 (GRCm39) missense probably damaging 1.00
R0147:Grid2 UTSW 6 64,510,571 (GRCm39) missense probably benign
R0193:Grid2 UTSW 6 64,040,937 (GRCm39) missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64,322,718 (GRCm39) missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64,643,036 (GRCm39) missense probably benign 0.33
R0600:Grid2 UTSW 6 63,480,419 (GRCm39) missense probably benign 0.38
R0717:Grid2 UTSW 6 64,643,259 (GRCm39) missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64,406,738 (GRCm39) missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64,406,668 (GRCm39) missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64,406,678 (GRCm39) nonsense probably null
R1762:Grid2 UTSW 6 64,510,638 (GRCm39) missense probably damaging 0.98
R1944:Grid2 UTSW 6 63,886,045 (GRCm39) missense probably damaging 1.00
R1961:Grid2 UTSW 6 63,885,877 (GRCm39) missense probably damaging 1.00
R1969:Grid2 UTSW 6 63,885,902 (GRCm39) nonsense probably null
R2138:Grid2 UTSW 6 64,322,782 (GRCm39) missense probably damaging 0.99
R3500:Grid2 UTSW 6 63,480,383 (GRCm39) missense probably damaging 0.97
R3547:Grid2 UTSW 6 64,297,005 (GRCm39) missense probably damaging 0.97
R3845:Grid2 UTSW 6 64,322,826 (GRCm39) missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63,480,417 (GRCm39) missense probably benign 0.41
R4273:Grid2 UTSW 6 63,886,029 (GRCm39) missense probably damaging 1.00
R4591:Grid2 UTSW 6 64,297,086 (GRCm39) missense probably damaging 1.00
R4701:Grid2 UTSW 6 64,642,899 (GRCm39) missense probably benign 0.27
R4721:Grid2 UTSW 6 64,643,185 (GRCm39) missense probably benign 0.33
R4755:Grid2 UTSW 6 63,885,972 (GRCm39) missense probably benign 0.04
R4869:Grid2 UTSW 6 64,406,724 (GRCm39) missense probably damaging 1.00
R5083:Grid2 UTSW 6 64,297,136 (GRCm39) nonsense probably null
R5091:Grid2 UTSW 6 64,053,862 (GRCm39) missense probably benign 0.07
R5117:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R5128:Grid2 UTSW 6 64,642,982 (GRCm39) missense probably benign 0.01
R5386:Grid2 UTSW 6 63,908,089 (GRCm39) missense probably damaging 0.99
R5404:Grid2 UTSW 6 63,907,894 (GRCm39) missense probably damaging 0.99
R5534:Grid2 UTSW 6 63,480,345 (GRCm39) missense probably benign
R5626:Grid2 UTSW 6 64,053,929 (GRCm39) critical splice donor site probably null
R5699:Grid2 UTSW 6 63,885,975 (GRCm39) missense probably damaging 0.99
R5700:Grid2 UTSW 6 64,071,416 (GRCm39) missense possibly damaging 0.95
R6446:Grid2 UTSW 6 64,322,577 (GRCm39) missense probably damaging 1.00
R6694:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63,907,999 (GRCm39) missense probably benign 0.01
R6895:Grid2 UTSW 6 64,372,283 (GRCm39) missense probably damaging 0.99
R6999:Grid2 UTSW 6 64,053,893 (GRCm39) missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64,677,402 (GRCm39) missense unknown
R7126:Grid2 UTSW 6 64,053,794 (GRCm39) missense probably damaging 0.99
R7432:Grid2 UTSW 6 64,252,854 (GRCm39) missense possibly damaging 0.46
R7553:Grid2 UTSW 6 64,053,925 (GRCm39) missense possibly damaging 0.95
R7619:Grid2 UTSW 6 63,908,085 (GRCm39) missense possibly damaging 0.71
R7997:Grid2 UTSW 6 64,297,120 (GRCm39) missense possibly damaging 0.89
R8112:Grid2 UTSW 6 63,885,891 (GRCm39) missense probably damaging 0.99
R8296:Grid2 UTSW 6 63,233,929 (GRCm39) critical splice donor site probably null
R8320:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R8467:Grid2 UTSW 6 64,510,635 (GRCm39) missense probably benign 0.01
R8691:Grid2 UTSW 6 63,480,321 (GRCm39) missense probably damaging 0.97
R8890:Grid2 UTSW 6 63,233,923 (GRCm39) missense probably benign
R8965:Grid2 UTSW 6 64,296,990 (GRCm39) missense probably damaging 1.00
R8968:Grid2 UTSW 6 64,643,139 (GRCm39) missense probably benign 0.14
R9220:Grid2 UTSW 6 63,885,888 (GRCm39) missense probably damaging 1.00
R9371:Grid2 UTSW 6 64,677,506 (GRCm39) missense unknown
R9653:Grid2 UTSW 6 63,907,968 (GRCm39) missense possibly damaging 0.75
Z1176:Grid2 UTSW 6 64,640,212 (GRCm39) missense probably benign 0.03
Z1176:Grid2 UTSW 6 63,885,863 (GRCm39) missense possibly damaging 0.76
Z1177:Grid2 UTSW 6 64,322,841 (GRCm39) missense probably damaging 1.00
Z1177:Grid2 UTSW 6 64,322,840 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGAGACCACTGGAGTTCAC -3'
(R):5'- AGGCAGGAGAGCACAATTCC -3'

Sequencing Primer
(F):5'- CCACTGGAGTTCACAAGAAAGTG -3'
(R):5'- AGAGCACAATTCCCGCGG -3'
Posted On 2017-10-20