Incidental Mutation 'R0529:1700010I14Rik'
List |< first << previous [record 47 of 32981] next >> last >|
ID49075
Institutional Source Beutler Lab
Gene Symbol 1700010I14Rik
Ensembl Gene ENSMUSG00000023873
Gene NameRIKEN cDNA 1700010I14 gene
Synonyms
MMRRC Submission 038721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.034) question?
Stock #R0529 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location8988333-9008319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8992396 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 126 (V126I)
Ref Sequence ENSEMBL: ENSMUSP00000118841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024650] [ENSMUST00000151609]
Predicted Effect probably benign
Transcript: ENSMUST00000024650
AA Change: V126I

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024650
Gene: ENSMUSG00000023873
AA Change: V126I

DomainStartEndE-ValueType
coiled coil region 135 165 N/A INTRINSIC
Pfam:TSNAXIP1_N 239 349 6.1e-36 PFAM
low complexity region 351 364 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
coiled coil region 421 466 N/A INTRINSIC
low complexity region 501 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136954
Predicted Effect probably benign
Transcript: ENSMUST00000151609
AA Change: V126I

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118841
Gene: ENSMUSG00000023873
AA Change: V126I

DomainStartEndE-ValueType
coiled coil region 135 165 N/A INTRINSIC
coiled coil region 321 370 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
coiled coil region 421 466 N/A INTRINSIC
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A C 5: 76,876,267 Y179* probably null Het
Afp A G 5: 90,504,395 Y415C probably damaging Het
Aldh5a1 G T 13: 24,913,873 T393K probably benign Het
Arhgef26 T C 3: 62,339,725 S77P probably benign Het
Axl A G 7: 25,787,287 probably benign Het
Card10 A G 15: 78,780,475 probably null Het
Ccdc71l G A 12: 32,379,252 S90N probably damaging Het
Cebpa A T 7: 35,120,199 T261S probably benign Het
Cnmd T C 14: 79,642,041 E219G probably benign Het
Cntln T A 4: 85,067,825 L1010H probably damaging Het
Cul9 A G 17: 46,520,468 probably benign Het
Cyld A G 8: 88,729,759 E479G probably benign Het
Dmp1 A G 5: 104,212,226 E256G probably benign Het
Dnmt1 T C 9: 20,911,550 D1140G probably damaging Het
Drd2 A C 9: 49,407,074 M439L probably benign Het
Drd3 G A 16: 43,822,714 V438M probably damaging Het
Dyrk3 A G 1: 131,130,121 I70T probably benign Het
Fam46c A G 3: 100,472,370 Y357H probably benign Het
Fbxo38 T C 18: 62,505,986 K1082E probably damaging Het
Fbxw10 A C 11: 62,859,845 D428A probably damaging Het
Fmn1 T A 2: 113,707,853 probably benign Het
Fmnl2 A T 2: 53,042,365 I119F probably damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Gda T A 19: 21,425,537 I82F probably damaging Het
Gpatch4 T A 3: 88,051,276 H22Q probably damaging Het
Gpr55 A G 1: 85,941,503 F119L probably benign Het
Gtf2i A T 5: 134,261,869 L425* probably null Het
Knstrn T A 2: 118,830,980 probably benign Het
Lipo2 T A 19: 33,746,935 I144L probably benign Het
Lrp1 T C 10: 127,541,594 probably null Het
Mtmr14 T C 6: 113,266,252 probably benign Het
Nsmce4a A T 7: 130,533,806 S345R probably benign Het
Oacyl T A 18: 65,742,219 V385D probably damaging Het
Olfr421-ps1 G A 1: 174,152,130 A205T probably benign Het
Olfr917 A T 9: 38,665,512 C111S probably benign Het
Phlpp2 T C 8: 109,876,971 S55P probably benign Het
Pkhd1l1 T A 15: 44,526,754 V1422E possibly damaging Het
Plcd3 T G 11: 103,080,187 H181P probably benign Het
Psmc5 G A 11: 106,261,164 probably null Het
Psmd11 T C 11: 80,470,689 probably benign Het
Rab39 T C 9: 53,686,716 Y83C probably damaging Het
Ric8a A G 7: 140,860,893 E93G probably damaging Het
Rtp3 T C 9: 110,987,084 E133G possibly damaging Het
Serpina1e A C 12: 103,949,104 L281R probably damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tmem63a A T 1: 180,961,094 E332V probably benign Het
Tnk1 T C 11: 69,855,164 T312A probably damaging Het
Traf3ip3 G T 1: 193,194,811 probably benign Het
Trappc11 A G 8: 47,526,979 V174A possibly damaging Het
Vmn1r174 G A 7: 23,754,197 R96H probably benign Het
Vmn1r7 T A 6: 57,024,465 Y270F possibly damaging Het
Vmn2r12 A G 5: 109,092,848 V133A probably benign Het
Vmn2r18 T A 5: 151,562,523 E502V probably damaging Het
Wipf3 C A 6: 54,485,363 P186Q probably damaging Het
Yipf5 A T 18: 40,212,162 M55K probably benign Het
Zbtb7a G A 10: 81,143,986 V5M probably damaging Het
Zfy1 G T Y: 726,040 S575Y probably damaging Het
Other mutations in 1700010I14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:1700010I14Rik APN 17 8997105 critical splice donor site probably null
IGL01569:1700010I14Rik APN 17 8996995 missense probably benign 0.33
IGL03024:1700010I14Rik APN 17 8993632 missense probably benign 0.33
IGL03410:1700010I14Rik APN 17 9001896 missense probably damaging 1.00
R0017:1700010I14Rik UTSW 17 9008106 utr 3 prime probably benign
R0017:1700010I14Rik UTSW 17 9008106 utr 3 prime probably benign
R0324:1700010I14Rik UTSW 17 9001157 missense probably benign 0.33
R0361:1700010I14Rik UTSW 17 8992546 missense probably benign 0.39
R0482:1700010I14Rik UTSW 17 8988423 critical splice donor site probably null
R1102:1700010I14Rik UTSW 17 8992628 missense probably damaging 1.00
R1964:1700010I14Rik UTSW 17 8992492 missense probably damaging 0.99
R3620:1700010I14Rik UTSW 17 9008032 missense probably benign 0.15
R4259:1700010I14Rik UTSW 17 8995234 missense probably damaging 1.00
R4261:1700010I14Rik UTSW 17 8995234 missense probably damaging 1.00
R4687:1700010I14Rik UTSW 17 8992153 missense probably damaging 1.00
R4707:1700010I14Rik UTSW 17 9005712 missense probably damaging 1.00
R4839:1700010I14Rik UTSW 17 9008013 missense probably benign 0.41
R4979:1700010I14Rik UTSW 17 9001811 missense probably damaging 1.00
R5225:1700010I14Rik UTSW 17 9008007 nonsense probably null
R5383:1700010I14Rik UTSW 17 8992700 missense possibly damaging 0.86
R6031:1700010I14Rik UTSW 17 8995252 missense possibly damaging 0.85
R6031:1700010I14Rik UTSW 17 8995252 missense possibly damaging 0.85
R6505:1700010I14Rik UTSW 17 9001940 missense probably benign 0.08
R6736:1700010I14Rik UTSW 17 8992268 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGGCGCAATTCCAACAGGAC -3'
(R):5'- ATACCAGCTAGGTAGGGGCTGATG -3'

Sequencing Primer
(F):5'- GGACATGGGAGAAACCCACC -3'
(R):5'- TGATGTAACGGTACACATCCCTG -3'
Posted On2013-06-12