Incidental Mutation 'R0530:Kndc1'
ID49104
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Namekinase non-catalytic C-lobe domain (KIND) containing 1
SynonymsB830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission 038722-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0530 (G1)
Quality Score221
Status Validated
Chromosome7
Chromosomal Location139894696-139941537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139901237 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 80 (I80F)
Ref Sequence ENSEMBL: ENSMUSP00000113856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]
Predicted Effect probably damaging
Transcript: ENSMUST00000053445
AA Change: I80F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: I80F

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121839
AA Change: I80F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129
AA Change: I80F

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
low complexity region 455 465 N/A INTRINSIC
Blast:KIND 466 539 7e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik A G 7: 29,530,120 noncoding transcript Het
Abcg3 A G 5: 104,936,054 W617R probably damaging Het
Cep83 A T 10: 94,719,588 probably benign Het
Ces1e G A 8: 93,219,521 probably benign Het
Ckap2 A G 8: 22,175,972 probably benign Het
Clip1 C A 5: 123,640,531 R443L probably damaging Het
Clmp A G 9: 40,761,006 D44G probably benign Het
Cntnap2 G A 6: 46,529,905 Q304* probably null Het
Cst7 A T 2: 150,570,515 probably benign Het
Dclk3 A T 9: 111,482,721 Y677F probably damaging Het
Dlat G T 9: 50,637,569 N562K probably damaging Het
Elmod1 A T 9: 53,925,976 Y182N probably damaging Het
Fam19a3 T C 3: 104,772,171 probably benign Het
Fzd10 T C 5: 128,602,013 F266L probably damaging Het
Gm5346 A T 8: 43,626,531 C219S probably benign Het
Gm7534 A G 4: 134,202,910 I28T probably benign Het
Gm8258 A G 5: 104,776,086 noncoding transcript Het
Gm9742 T A 13: 8,030,005 noncoding transcript Het
Hdlbp T C 1: 93,430,317 probably benign Het
Itga8 A G 2: 12,191,816 S597P probably damaging Het
Ktn1 A G 14: 47,733,243 N1192S probably benign Het
Ldha G A 7: 46,853,993 V270M probably damaging Het
Lyst T C 13: 13,757,306 probably benign Het
Map3k9 A T 12: 81,722,482 F954I probably benign Het
Mroh2b A G 15: 4,934,395 N823S probably damaging Het
Mycbp2 A T 14: 103,182,459 N2480K probably damaging Het
Nat1 A G 8: 67,491,325 K121E probably benign Het
Neurl1b T A 17: 26,441,545 probably null Het
Nnt C A 13: 119,394,721 L163F probably damaging Het
Olfr1417 A G 19: 11,828,192 V278A probably benign Het
Otog A G 7: 46,298,244 T2274A probably damaging Het
Pde4b G A 4: 102,602,651 R561Q probably damaging Het
Pitpnm2 A G 5: 124,131,201 F453L probably damaging Het
Pms1 T C 1: 53,196,813 probably null Het
Pot1a A G 6: 25,771,541 V227A possibly damaging Het
Prdx6b A G 2: 80,293,315 N156S probably damaging Het
Ptpn9 A G 9: 57,061,133 S586G probably benign Het
Serpina6 A T 12: 103,651,794 N253K probably damaging Het
Slc12a2 T A 18: 57,919,536 V809D possibly damaging Het
Slc2a8 C T 2: 32,973,684 A449T probably benign Het
Slc6a6 A G 6: 91,724,958 I116V probably null Het
Synj2 T A 17: 6,008,105 S58R possibly damaging Het
Tktl2 T C 8: 66,513,179 V463A probably damaging Het
Uchl5 T C 1: 143,794,344 V105A possibly damaging Het
Usp9y T C Y: 1,333,600 probably benign Het
Vmn1r200 T C 13: 22,395,497 S148P probably damaging Het
Vmn2r50 A T 7: 10,047,717 M367K possibly damaging Het
Vps13a T C 19: 16,655,206 probably benign Het
Wdr26 A T 1: 181,186,070 probably null Het
Ythdc2 T A 18: 44,850,398 M544K probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense not run
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGTGACATTCAAGGGACAGCAGG -3'
(R):5'- TCAGATTCCCAAAGAAACTGGGGC -3'

Sequencing Primer
(F):5'- ACTCTGTCTATAAAAGGGCCTGG -3'
(R):5'- GCCTCGTGTCCTCCCTTG -3'
Posted On2013-06-12