Incidental Mutation 'R0531:Notch1'
ID49138
Institutional Source Beutler Lab
Gene Symbol Notch1
Ensembl Gene ENSMUSG00000026923
Gene Namenotch 1
SynonymsTan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0531 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26457903-26516663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26466572 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1678 (S1678P)
Ref Sequence ENSEMBL: ENSMUSP00000028288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]
PDB Structure
The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028288
AA Change: S1678P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: S1678P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 23 58 1.63e1 SMART
EGF 62 99 4.29e-5 SMART
EGF 105 139 6.25e-7 SMART
EGF_CA 140 176 1.02e-6 SMART
EGF_CA 178 216 4.21e-13 SMART
EGF 221 255 6.7e-7 SMART
EGF_CA 257 293 6.8e-8 SMART
EGF_CA 295 333 1.16e-10 SMART
EGF_CA 335 371 3.17e-8 SMART
EGF 375 410 5.32e-1 SMART
EGF_CA 412 450 4.59e-14 SMART
EGF_CA 452 488 1.02e-11 SMART
EGF_CA 490 526 4.81e-8 SMART
EGF_CA 528 564 3.19e-13 SMART
EGF_CA 566 601 1.91e-11 SMART
EGF_CA 603 639 1.78e-11 SMART
EGF_CA 641 676 9.62e-8 SMART
EGF_CA 678 714 2.38e-12 SMART
EGF_CA 716 751 5.23e-9 SMART
EGF_CA 753 789 6.25e-7 SMART
EGF_CA 791 827 1.1e-11 SMART
EGF 832 867 2.03e-6 SMART
EGF_CA 869 905 5.73e-15 SMART
EGF_CA 907 943 4.56e-9 SMART
EGF_CA 945 981 1.64e-10 SMART
EGF_CA 983 1019 5.83e-7 SMART
EGF_CA 1021 1057 1.05e-13 SMART
EGF 1062 1095 8.12e-6 SMART
EGF 1100 1143 5.66e-5 SMART
EGF_CA 1145 1181 1.1e-11 SMART
EGF_CA 1183 1219 3.87e-12 SMART
EGF_CA 1221 1265 2.89e-11 SMART
EGF_CA 1267 1305 1.2e-8 SMART
EGF 1310 1346 5.74e-6 SMART
EGF 1351 1384 4.1e-2 SMART
EGF 1390 1426 2.66e-1 SMART
NL 1442 1480 4.08e-16 SMART
NL 1483 1522 1.08e-15 SMART
NL 1523 1562 7.39e-14 SMART
NOD 1566 1622 1.81e-32 SMART
NODP 1660 1722 3.27e-30 SMART
low complexity region 1729 1746 N/A INTRINSIC
ANK 1870 1912 1.07e2 SMART
ANK 1917 1946 4.82e-3 SMART
ANK 1950 1980 6.71e-2 SMART
ANK 1984 2013 1.23e0 SMART
ANK 2017 2046 9.13e-4 SMART
ANK 2050 2079 2.97e-3 SMART
low complexity region 2205 2222 N/A INTRINSIC
low complexity region 2364 2395 N/A INTRINSIC
DUF3454 2453 2517 2.01e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129506
Predicted Effect probably benign
Transcript: ENSMUST00000132820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138034
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183922
Meta Mutation Damage Score 0.1084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Notch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Notch1 APN 2 26460046 missense probably damaging 0.98
IGL01343:Notch1 APN 2 26472905 missense probably benign 0.25
IGL02066:Notch1 APN 2 26460396 missense possibly damaging 0.71
IGL02158:Notch1 APN 2 26460339 missense probably damaging 1.00
IGL02541:Notch1 APN 2 26468503 missense probably benign 0.12
IGL03280:Notch1 APN 2 26477874 intron probably benign
IGL03338:Notch1 APN 2 26459959 missense probably benign
Antero UTSW 2 26476114 missense possibly damaging 0.96
march UTSW 2 26469899 missense probably damaging 0.98
PIT4494001:Notch1 UTSW 2 26466473 missense probably damaging 1.00
R0013:Notch1 UTSW 2 26473818 missense possibly damaging 0.64
R0025:Notch1 UTSW 2 26470931 missense probably damaging 1.00
R0129:Notch1 UTSW 2 26460458 missense probably benign 0.06
R0285:Notch1 UTSW 2 26460861 missense possibly damaging 0.88
R0747:Notch1 UTSW 2 26472140 missense unknown
R1440:Notch1 UTSW 2 26480964 intron probably benign
R1502:Notch1 UTSW 2 26484323 missense possibly damaging 0.95
R1539:Notch1 UTSW 2 26472113 nonsense probably null
R1623:Notch1 UTSW 2 26478612 missense possibly damaging 0.88
R1844:Notch1 UTSW 2 26460434 missense probably benign 0.12
R1863:Notch1 UTSW 2 26469950 missense probably damaging 1.00
R1874:Notch1 UTSW 2 26481579 missense possibly damaging 0.89
R1926:Notch1 UTSW 2 26481657 missense probably damaging 1.00
R2156:Notch1 UTSW 2 26460861 missense possibly damaging 0.91
R2196:Notch1 UTSW 2 26463804 nonsense probably null
R2209:Notch1 UTSW 2 26460007 missense probably benign
R2382:Notch1 UTSW 2 26473781 missense probably benign 0.40
R2508:Notch1 UTSW 2 26465473 missense possibly damaging 0.80
R2873:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R2874:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R3798:Notch1 UTSW 2 26478618 missense probably benign 0.00
R4019:Notch1 UTSW 2 26481142 missense probably benign 0.03
R4305:Notch1 UTSW 2 26477924 missense probably damaging 1.00
R4334:Notch1 UTSW 2 26460036 missense probably benign 0.22
R4504:Notch1 UTSW 2 26472177 missense probably benign 0.16
R4624:Notch1 UTSW 2 26478081 missense possibly damaging 0.94
R4659:Notch1 UTSW 2 26470889 missense probably damaging 0.99
R4703:Notch1 UTSW 2 26471158 missense probably benign
R4869:Notch1 UTSW 2 26471179 missense probably benign 0.21
R4938:Notch1 UTSW 2 26474124 nonsense probably null
R4989:Notch1 UTSW 2 26481181 missense probably damaging 1.00
R5010:Notch1 UTSW 2 26476114 missense possibly damaging 0.96
R5283:Notch1 UTSW 2 26468626 missense probably damaging 1.00
R5303:Notch1 UTSW 2 26478619 missense probably benign 0.01
R5635:Notch1 UTSW 2 26476161 missense probably damaging 1.00
R5755:Notch1 UTSW 2 26473692 missense probably benign 0.12
R5926:Notch1 UTSW 2 26476104 missense probably benign 0.35
R5947:Notch1 UTSW 2 26462528 intron probably benign
R6053:Notch1 UTSW 2 26472912 missense probably benign 0.06
R6161:Notch1 UTSW 2 26468731 missense probably damaging 1.00
R6162:Notch1 UTSW 2 26462195 missense probably benign
R6174:Notch1 UTSW 2 26485442 missense possibly damaging 0.50
R6199:Notch1 UTSW 2 26469899 missense probably damaging 0.98
R6209:Notch1 UTSW 2 26472805 missense probably damaging 1.00
R6251:Notch1 UTSW 2 26474170 missense possibly damaging 0.64
R6493:Notch1 UTSW 2 26472098 missense unknown
R6723:Notch1 UTSW 2 26478106 missense probably damaging 1.00
R6736:Notch1 UTSW 2 26460286 missense probably benign 0.01
R7020:Notch1 UTSW 2 26481574 missense possibly damaging 0.95
R7058:Notch1 UTSW 2 26463818 missense probably benign 0.05
R7154:Notch1 UTSW 2 26459938 missense probably benign
R7291:Notch1 UTSW 2 26476375 missense probably benign 0.01
X0018:Notch1 UTSW 2 26462227 nonsense probably null
X0066:Notch1 UTSW 2 26470335 missense possibly damaging 0.90
Z1088:Notch1 UTSW 2 26477115 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGAACCCATCCCTGAAGAGGCAG -3'
(R):5'- AAGGCTAGACAGTGGAATGACCCC -3'

Sequencing Primer
(F):5'- ggatttgaacccttgtcctctg -3'
(R):5'- CGCTGAGTGCTAAACACTG -3'
Posted On2013-06-12