Incidental Mutation 'R0531:Sall4'
ID49141
Institutional Source Beutler Lab
Gene Symbol Sall4
Ensembl Gene ENSMUSG00000027547
Gene Namespalt like transcription factor 4
Synonyms5730441M18Rik, Tex20, C330011P20Rik
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0531 (G1)
Quality Score176
Status Validated
Chromosome2
Chromosomal Location168748332-168767943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 168756336 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 195 (A195T)
Ref Sequence ENSEMBL: ENSMUSP00000099363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029061] [ENSMUST00000075044] [ENSMUST00000103074] [ENSMUST00000137536] [ENSMUST00000150588]
Predicted Effect probably benign
Transcript: ENSMUST00000029061
AA Change: A195T

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029061
Gene: ENSMUSG00000027547
AA Change: A195T

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
ZnF_C2H2 68 88 1.31e2 SMART
low complexity region 193 203 N/A INTRINSIC
low complexity region 210 230 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
low complexity region 295 313 N/A INTRINSIC
ZnF_C2H2 387 409 1.04e-3 SMART
ZnF_C2H2 415 437 2.15e-5 SMART
ZnF_C2H2 573 595 5.34e0 SMART
ZnF_C2H2 601 623 1.22e-4 SMART
ZnF_C2H2 633 655 1.84e-4 SMART
low complexity region 855 867 N/A INTRINSIC
ZnF_C2H2 880 902 2.53e-2 SMART
ZnF_C2H2 908 930 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075044
SMART Domains Protein: ENSMUSP00000074556
Gene: ENSMUSG00000027547

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 30 38 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
ZnF_C2H2 91 113 2.53e-2 SMART
ZnF_C2H2 119 141 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103074
AA Change: A195T

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099363
Gene: ENSMUSG00000027547
AA Change: A195T

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
ZnF_C2H2 68 88 1.31e2 SMART
low complexity region 193 203 N/A INTRINSIC
low complexity region 210 230 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
low complexity region 295 313 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 436 458 2.53e-2 SMART
ZnF_C2H2 464 486 1.13e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130640
Predicted Effect probably benign
Transcript: ENSMUST00000137536
AA Change: A164T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115646
Gene: ENSMUSG00000027547
AA Change: A164T

DomainStartEndE-ValueType
Blast:ZnF_C2H2 37 61 6e-9 BLAST
low complexity region 162 172 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150588
SMART Domains Protein: ENSMUSP00000119628
Gene: ENSMUSG00000027547

DomainStartEndE-ValueType
ZnF_C2H2 64 86 1.22e-4 SMART
ZnF_C2H2 96 118 1.84e-4 SMART
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene belongs to the spalt family of zinc finger transcription factors. In mouse, functions for this gene have been described in many embryonic developmental processes, including brain, heart, and limb development. In addition, this gene is an important pluripotency factor that is required for stem cell maintenance. Homozygous mutant mice display embryonic lethality, while conditional knock-out in embryonic germ cells results in failure to establish a robust stem cell population. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality before somite formation. Heterozygous mutation of this locus causes variable phenotypes, from heart and digit defects to deafness, anogenital tract defects, cranial and carpal bone defects and renal agenesis or hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Sall4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Sall4 APN 2 168755312 missense probably benign 0.02
IGL00592:Sall4 APN 2 168755963 missense probably damaging 1.00
IGL00674:Sall4 APN 2 168755780 missense probably damaging 0.99
IGL01308:Sall4 APN 2 168750244 missense probably damaging 0.99
IGL01538:Sall4 APN 2 168755856 missense probably damaging 1.00
IGL01552:Sall4 APN 2 168756123 missense probably damaging 1.00
IGL02614:Sall4 APN 2 168755885 missense probably null 0.79
R0514:Sall4 UTSW 2 168755705 missense probably damaging 1.00
R0747:Sall4 UTSW 2 168754966 missense probably damaging 1.00
R1371:Sall4 UTSW 2 168756474 missense probably benign 0.10
R1736:Sall4 UTSW 2 168752635 missense probably benign 0.10
R2067:Sall4 UTSW 2 168756545 missense probably benign 0.00
R3766:Sall4 UTSW 2 168756044 missense possibly damaging 0.93
R3783:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3784:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3785:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3787:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3877:Sall4 UTSW 2 168756242 missense probably damaging 1.00
R4356:Sall4 UTSW 2 168755480 missense probably benign 0.37
R4358:Sall4 UTSW 2 168755480 missense probably benign 0.37
R4760:Sall4 UTSW 2 168750427 missense probably damaging 0.98
R4869:Sall4 UTSW 2 168755717 missense probably damaging 1.00
R5979:Sall4 UTSW 2 168750343 missense probably benign 0.28
R6089:Sall4 UTSW 2 168755486 missense possibly damaging 0.92
R6502:Sall4 UTSW 2 168755708 missense probably damaging 1.00
R6990:Sall4 UTSW 2 168755070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGGACACTTGCTGAGACAC -3'
(R):5'- TCAGAGGACTTTTCCAGAGCTGCC -3'

Sequencing Primer
(F):5'- ACTTGCTGAGACACATGGC -3'
(R):5'- TTTCCAGAGCTGCCCTGAG -3'
Posted On2013-06-12