Incidental Mutation 'R0531:Inpp5b'
ID49146
Institutional Source Beutler Lab
Gene Symbol Inpp5b
Ensembl Gene ENSMUSG00000028894
Gene Nameinositol polyphosphate-5-phosphatase B
Synonyms75kDa
MMRRC Submission 038723-MU
Accession Numbers

Ncbi RefSeq: NM_008385.3; MGI:103257

Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R0531 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location124741850-124801511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124795456 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 843 (N843I)
Ref Sequence ENSEMBL: ENSMUSP00000092375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094782] [ENSMUST00000184454]
PDB Structure
A PH domain within OCRL bridges clathrin mediated membrane trafficking to phosphoinositide metabolism [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000094782
AA Change: N843I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092375
Gene: ENSMUSG00000028894
AA Change: N843I

DomainStartEndE-ValueType
Pfam:INPP5B_PH 1 150 4.3e-61 PFAM
low complexity region 206 220 N/A INTRINSIC
IPPc 343 644 6.29e-126 SMART
Blast:RhoGAP 706 732 1e-7 BLAST
Blast:RhoGAP 755 809 2e-24 BLAST
RhoGAP 827 993 6.77e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142446
Predicted Effect probably benign
Transcript: ENSMUST00000184454
SMART Domains Protein: ENSMUSP00000139221
Gene: ENSMUSG00000028894

DomainStartEndE-ValueType
PDB:2KIG|A 1 156 1e-105 PDB
low complexity region 206 220 N/A INTRINSIC
IPPc 343 644 6.29e-126 SMART
PDB:3QBT|H 645 782 6e-49 PDB
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype Strain: 2159609;2159620
FUNCTION: This gene encodes a member of the inositol polyphosphate-5-phosphatase (INPP5) family. This protein hydrolyzes the 5' phosphate from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol-1,4,5-trisphosphate, which results in changes to multiple signaling pathways. This protein may be involved in protein trafficking and secretion. Homozygous knockout mice exhibit impaired spermatogenesis and male sterility. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null male mice are infertile with a disruption in spermatogenesis and a defect in adherens junctions processing. [provided by MGI curators]
Allele List at MGI

All alleles(24) : Targeted(6) Gene trapped(18)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Inpp5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Inpp5b APN 4 124784375 missense possibly damaging 0.94
IGL00696:Inpp5b APN 4 124742535 start codon destroyed probably null 1.00
IGL00969:Inpp5b APN 4 124783994 missense probably damaging 1.00
IGL01401:Inpp5b APN 4 124746087 missense probably damaging 0.97
IGL01481:Inpp5b APN 4 124800699 unclassified probably null
IGL01517:Inpp5b APN 4 124782436 missense probably benign 0.00
IGL03085:Inpp5b APN 4 124792322 missense probably benign 0.01
IGL03178:Inpp5b APN 4 124785254 missense probably benign 0.02
R6450_Inpp5b_335 UTSW 4 124792252 missense probably damaging 1.00
P0042:Inpp5b UTSW 4 124797910 critical splice donor site probably null
R0504:Inpp5b UTSW 4 124782408 nonsense probably null
R1396:Inpp5b UTSW 4 124789080 missense probably damaging 1.00
R1626:Inpp5b UTSW 4 124783903 missense probably damaging 1.00
R1768:Inpp5b UTSW 4 124793276 nonsense probably null
R2037:Inpp5b UTSW 4 124798299 missense probably damaging 0.98
R2119:Inpp5b UTSW 4 124797869 missense probably benign 0.00
R2132:Inpp5b UTSW 4 124785168 splice site probably benign
R2190:Inpp5b UTSW 4 124785195 missense probably damaging 1.00
R3237:Inpp5b UTSW 4 124780486 missense probably benign 0.04
R3800:Inpp5b UTSW 4 124785345 missense probably damaging 1.00
R4735:Inpp5b UTSW 4 124783967 missense probably damaging 0.99
R4827:Inpp5b UTSW 4 124743850 intron probably benign
R4865:Inpp5b UTSW 4 124751495 missense probably benign
R4868:Inpp5b UTSW 4 124751410 missense probably damaging 0.99
R4913:Inpp5b UTSW 4 124780421 missense probably benign 0.09
R5055:Inpp5b UTSW 4 124743031 critical splice donor site probably null
R5068:Inpp5b UTSW 4 124742649 intron probably null
R5208:Inpp5b UTSW 4 124751317 missense possibly damaging 0.62
R5642:Inpp5b UTSW 4 124782436 missense probably benign 0.00
R5875:Inpp5b UTSW 4 124780406 missense possibly damaging 0.66
R6015:Inpp5b UTSW 4 124798350 missense possibly damaging 0.94
R6288:Inpp5b UTSW 4 124785227 missense probably benign 0.00
R6450:Inpp5b UTSW 4 124792252 missense probably damaging 1.00
R7138:Inpp5b UTSW 4 124785272 missense probably damaging 1.00
R7235:Inpp5b UTSW 4 124751392 missense probably benign 0.04
R7382:Inpp5b UTSW 4 124751577 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTGTCCTATCATGCAGCCAGCC -3'
(R):5'- TCCTCCCATTCTCAGAAGCAGGTG -3'

Sequencing Primer
(F):5'- CAGCCAGCCTGGTAGAAG -3'
(R):5'- AGGGCATTCAGAAGTCCTTCC -3'
Posted On2013-06-12