Incidental Mutation 'R0531:Srpr'
ID49163
Institutional Source Beutler Lab
Gene Symbol Srpr
Ensembl Gene ENSMUSG00000032042
Gene Namesignal recognition particle receptor ('docking protein')
SynonymsD11Mgi27, 1300011P19Rik
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R0531 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35200175-35247973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35213501 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 133 (T133A)
Ref Sequence ENSEMBL: ENSMUSP00000149923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034541] [ENSMUST00000043805] [ENSMUST00000059057] [ENSMUST00000063782] [ENSMUST00000121564] [ENSMUST00000127996] [ENSMUST00000132799] [ENSMUST00000138287] [ENSMUST00000138692] [ENSMUST00000139703] [ENSMUST00000142595] [ENSMUST00000151658] [ENSMUST00000154691]
Predicted Effect probably benign
Transcript: ENSMUST00000034541
AA Change: T268A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034541
Gene: ENSMUSG00000032042
AA Change: T268A

DomainStartEndE-ValueType
Pfam:SRP-alpha_N 27 301 4.4e-69 PFAM
SRP54_N 318 395 4.04e-6 SMART
AAA 415 568 9.65e-10 SMART
SRP54 416 635 3.47e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043805
SMART Domains Protein: ENSMUSP00000038924
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 462 2.8e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059057
SMART Domains Protein: ENSMUSP00000058377
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063782
SMART Domains Protein: ENSMUSP00000066281
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
Pfam:SIR2_2 75 225 7.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121564
SMART Domains Protein: ENSMUSP00000113537
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127996
SMART Domains Protein: ENSMUSP00000118037
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 456 1.8e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130072
Predicted Effect probably benign
Transcript: ENSMUST00000132799
SMART Domains Protein: ENSMUSP00000115104
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP54 3 132 8.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133739
SMART Domains Protein: ENSMUSP00000121690
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138287
AA Change: T133A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000138692
SMART Domains Protein: ENSMUSP00000120556
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139703
SMART Domains Protein: ENSMUSP00000122535
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 184 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142595
SMART Domains Protein: ENSMUSP00000117147
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 187 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151082
Predicted Effect probably benign
Transcript: ENSMUST00000151658
SMART Domains Protein: ENSMUSP00000120284
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 121 5.8e-9 PFAM
low complexity region 128 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154005
Predicted Effect probably benign
Transcript: ENSMUST00000154691
SMART Domains Protein: ENSMUSP00000123496
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a subunit of the endoplasmic reticulum signal recognition particle receptor that, in conjunction with the signal recognition particle, is involved in the targeting and translocation of signal sequence tagged secretory and membrane proteins across the endoplasmic reticulum. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Srpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Srpr APN 9 35213438 missense probably damaging 1.00
IGL01806:Srpr APN 9 35214905 missense possibly damaging 0.90
IGL02581:Srpr APN 9 35215032 critical splice donor site probably null
IGL03002:Srpr APN 9 35214721 missense probably damaging 0.98
IGL03132:Srpr APN 9 35214278 splice site probably null
R0294:Srpr UTSW 9 35215515 missense probably damaging 1.00
R0455:Srpr UTSW 9 35214981 missense probably benign 0.01
R0483:Srpr UTSW 9 35215995 missense possibly damaging 0.95
R1112:Srpr UTSW 9 35214959 missense probably benign 0.03
R1507:Srpr UTSW 9 35215470 missense probably benign 0.08
R1771:Srpr UTSW 9 35212851 missense possibly damaging 0.69
R1970:Srpr UTSW 9 35213538 unclassified probably null
R1971:Srpr UTSW 9 35213538 unclassified probably null
R2442:Srpr UTSW 9 35212001 missense possibly damaging 0.90
R4475:Srpr UTSW 9 35212859 missense possibly damaging 0.92
R4575:Srpr UTSW 9 35214608 missense possibly damaging 0.92
R4576:Srpr UTSW 9 35214608 missense possibly damaging 0.92
R4578:Srpr UTSW 9 35214608 missense possibly damaging 0.92
R4793:Srpr UTSW 9 35213151 missense probably benign 0.12
R4930:Srpr UTSW 9 35215030 missense probably benign 0.00
R4942:Srpr UTSW 9 35215470 missense probably benign 0.08
R5517:Srpr UTSW 9 35211350 missense probably benign
R6208:Srpr UTSW 9 35215995 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGTCAGCACTGTTACCCTGTCTC -3'
(R):5'- CAATCCAGATCTTGAAGCTGTCCCC -3'

Sequencing Primer
(F):5'- CTGGTGACTGTTACCCAGC -3'
(R):5'- GCCCAGTTCCTCGAATCTAGAG -3'
Posted On2013-06-12