Incidental Mutation 'R0531:Best3'
ID49171
Institutional Source Beutler Lab
Gene Symbol Best3
Ensembl Gene ENSMUSG00000020169
Gene Namebestrophin 3
SynonymsmBest4, Vmd2l3
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R0531 (G1)
Quality Score173
Status Validated
Chromosome10
Chromosomal Location116986314-117025040 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 117004375 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020378]
Predicted Effect probably benign
Transcript: ENSMUST00000020378
SMART Domains Protein: ENSMUSP00000020378
Gene: ENSMUSG00000020169

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 7.3e-115 PFAM
low complexity region 405 416 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BEST3 belongs to the bestrophin family of anion channels, which includes BEST1 (MIM 607854), the gene mutant in vitelliform macular dystrophy (VMD; MIM 153700), and 2 other BEST1-like genes, BEST2 (MIM 607335) and BEST4 (MIM 607336). Bestrophins are transmembrane (TM) proteins that share a homology region containing a high content of aromatic residues, including an invariant arg-phe-pro (RFP) motif. The bestrophin genes share a conserved gene structure, with almost identical sizes of the 8 RFP-TM domain-encoding exons and highly conserved exon-intron boundaries. Each of the 4 bestrophin genes has a unique 3-prime end of variable length (Stohr et al., 2002 [PubMed 12032738]; Tsunenari et al., 2003 [PubMed 12907679]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Best3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Best3 APN 10 116988727 missense probably damaging 1.00
IGL00158:Best3 APN 10 117004541 splice site probably benign
IGL02493:Best3 APN 10 117024601 missense possibly damaging 0.95
IGL02713:Best3 APN 10 117024529 missense probably benign 0.00
IGL03178:Best3 APN 10 116988779 missense probably damaging 1.00
IGL03355:Best3 APN 10 116993105 missense possibly damaging 0.82
R0578:Best3 UTSW 10 117008999 missense probably benign 0.06
R1671:Best3 UTSW 10 117024668 missense possibly damaging 0.58
R1769:Best3 UTSW 10 117023978 missense probably benign 0.00
R1860:Best3 UTSW 10 116993273 missense probably damaging 1.00
R1935:Best3 UTSW 10 117024386 missense probably benign
R2103:Best3 UTSW 10 117002594 missense probably benign 0.01
R3942:Best3 UTSW 10 116988674 missense possibly damaging 0.49
R4260:Best3 UTSW 10 117024226 missense probably benign
R4332:Best3 UTSW 10 117002524 missense probably benign 0.37
R4741:Best3 UTSW 10 117023996 missense probably benign 0.06
R4760:Best3 UTSW 10 117024794 missense probably benign 0.00
R4896:Best3 UTSW 10 117024555 missense probably benign 0.00
R4912:Best3 UTSW 10 117008981 missense probably damaging 1.00
R5023:Best3 UTSW 10 116988742 missense probably benign 0.06
R5087:Best3 UTSW 10 117009002 missense probably benign 0.01
R5213:Best3 UTSW 10 117024472 missense probably benign 0.01
R5457:Best3 UTSW 10 117004511 missense probably damaging 1.00
R5928:Best3 UTSW 10 117007627 missense probably damaging 1.00
R5982:Best3 UTSW 10 117004417 missense probably damaging 0.98
R6335:Best3 UTSW 10 117002651 missense probably benign 0.32
R7068:Best3 UTSW 10 116988638 missense probably damaging 1.00
R7469:Best3 UTSW 10 117004385 missense probably damaging 1.00
Z1088:Best3 UTSW 10 117024170 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCATTCCGCTGGTTTACACAC -3'
(R):5'- GACACAGAGATTGTCGCCTACCTTG -3'

Sequencing Primer
(F):5'- atctccctatgtccacccc -3'
(R):5'- ACCTTGAGCCATCCTGCG -3'
Posted On2013-06-12