Incidental Mutation 'R0531:Senp1'
ID49188
Institutional Source Beutler Lab
Gene Symbol Senp1
Ensembl Gene ENSMUSG00000033075
Gene NameSUMO1/sentrin specific peptidase 1
Synonyms2310046A20Rik, D15Ertd528e, E330036L07Rik
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0531 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98038744-98093744 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 98064880 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044189] [ENSMUST00000180657] [ENSMUST00000180716]
Predicted Effect probably benign
Transcript: ENSMUST00000044189
SMART Domains Protein: ENSMUSP00000046598
Gene: ENSMUSG00000033075

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 357 375 N/A INTRINSIC
Pfam:Peptidase_C48 460 638 1.3e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157700
Predicted Effect probably benign
Transcript: ENSMUST00000180657
SMART Domains Protein: ENSMUSP00000138056
Gene: ENSMUSG00000033075

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
low complexity region 183 192 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
low complexity region 383 401 N/A INTRINSIC
Pfam:Peptidase_C48 486 664 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180716
SMART Domains Protein: ENSMUSP00000138032
Gene: ENSMUSG00000033075

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181855
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cysteine protease that specifically targets members of the small ubiquitin-like modifier (SUMO) protein family. This protease regulates SUMO pathways by deconjugating sumoylated proteins. This protease also functions to process the precursor SUMO proteins into their mature form. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous mutant mice die before birth. Depending on the allele mice may exhibit placental labyrinth defects and widespread cell death or severe anemia and a defect in definitive erythropoiesis in the fetal liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Fkbp5 A T 17: 28,438,029 H71Q probably benign Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Senp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Senp1 APN 15 98064838 missense probably damaging 1.00
IGL01431:Senp1 APN 15 98082263 missense probably damaging 0.97
IGL02674:Senp1 APN 15 98056959 missense probably damaging 0.99
IGL03289:Senp1 APN 15 98085045 missense probably damaging 1.00
Calmate UTSW 15 98066498 missense probably benign 0.00
mustard UTSW 15 98048271 missense probably damaging 1.00
nitrogen UTSW 15 98066531 missense possibly damaging 0.61
Sinapis UTSW 15 98064880 splice site probably benign
PIT1430001:Senp1 UTSW 15 98084989 missense probably damaging 1.00
R0026:Senp1 UTSW 15 98076668 missense probably damaging 0.99
R0026:Senp1 UTSW 15 98076668 missense probably damaging 0.99
R0125:Senp1 UTSW 15 98048231 missense probably damaging 0.99
R1389:Senp1 UTSW 15 98075853 missense probably benign 0.03
R1396:Senp1 UTSW 15 98076554 missense probably benign 0.01
R1786:Senp1 UTSW 15 98075967 missense probably benign 0.00
R1999:Senp1 UTSW 15 98058315 missense possibly damaging 0.61
R2045:Senp1 UTSW 15 98059944 missense possibly damaging 0.57
R2130:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2132:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2133:Senp1 UTSW 15 98075967 missense probably benign 0.00
R2150:Senp1 UTSW 15 98058315 missense possibly damaging 0.61
R2327:Senp1 UTSW 15 98082284 missense probably damaging 1.00
R3815:Senp1 UTSW 15 98056832 missense probably damaging 1.00
R4719:Senp1 UTSW 15 98056850 missense probably benign 0.42
R4766:Senp1 UTSW 15 98045896 missense probably damaging 0.98
R4866:Senp1 UTSW 15 98066848 missense possibly damaging 0.93
R5141:Senp1 UTSW 15 98076607 missense probably benign 0.08
R5485:Senp1 UTSW 15 98066496 missense probably benign 0.00
R5651:Senp1 UTSW 15 98076617 missense probably benign
R5668:Senp1 UTSW 15 98048355 missense probably damaging 1.00
R5729:Senp1 UTSW 15 98066531 missense possibly damaging 0.61
R6041:Senp1 UTSW 15 98058216 missense probably damaging 0.97
R6395:Senp1 UTSW 15 98048193 missense probably damaging 1.00
R6521:Senp1 UTSW 15 98048271 missense probably damaging 1.00
R7070:Senp1 UTSW 15 98082306 missense possibly damaging 0.66
R7075:Senp1 UTSW 15 98058326 missense probably benign 0.00
R7262:Senp1 UTSW 15 98066498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACTACTTGGGATGGTGCAAGAC -3'
(R):5'- TCTTATTTGTGAGGCACAGTGGAGC -3'

Sequencing Primer
(F):5'- aaggaaggaagaaggaagagaag -3'
(R):5'- ACAGTGGAGCTGCTCCTC -3'
Posted On2013-06-12