Incidental Mutation 'R0531:Fkbp5'
ID49196
Institutional Source Beutler Lab
Gene Symbol Fkbp5
Ensembl Gene ENSMUSG00000024222
Gene NameFK506 binding protein 5
SynonymsFKBP51, D17Ertd592e, Dit1
MMRRC Submission 038723-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0531 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28399095-28517524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28438029 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 71 (H71Q)
Ref Sequence ENSEMBL: ENSMUSP00000136245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079413] [ENSMUST00000114792] [ENSMUST00000153744] [ENSMUST00000177939]
Predicted Effect probably benign
Transcript: ENSMUST00000079413
AA Change: H71Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078382
Gene: ENSMUSG00000024222
AA Change: H71Q

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 7.1e-31 PFAM
Pfam:FKBP_C 158 248 2.1e-14 PFAM
TPR 268 301 9.48e1 SMART
TPR 317 350 1.45e-6 SMART
TPR 351 384 1.23e-4 SMART
low complexity region 421 440 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114792
AA Change: H71Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110440
Gene: ENSMUSG00000024222
AA Change: H71Q

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 7.1e-31 PFAM
Pfam:FKBP_C 158 248 2.1e-14 PFAM
TPR 268 301 9.48e1 SMART
TPR 317 350 1.45e-6 SMART
TPR 351 384 1.23e-4 SMART
low complexity region 421 440 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153744
AA Change: H71Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116466
Gene: ENSMUSG00000024222
AA Change: H71Q

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 8e-32 PFAM
internal_repeat_1 138 182 6.75e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000177939
AA Change: H71Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136245
Gene: ENSMUSG00000024222
AA Change: H71Q

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 8.8e-32 PFAM
Pfam:FKBP_C 158 248 1.8e-15 PFAM
TPR 268 301 9.48e1 SMART
TPR 317 350 1.45e-6 SMART
TPR 351 384 1.23e-4 SMART
low complexity region 421 440 N/A INTRINSIC
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It is thought to mediate calcineurin inhibition. It also interacts functionally with mature hetero-oligomeric progesterone receptor complexes along with the 90 kDa heat shock protein and P23 protein. This gene has been found to have multiple polyadenylation sites. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele are normal and fertile. Mice homozygous for another knock-out allele exhibit decreased depression-related behavior and increased anxiety-related behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,915,146 N130D probably benign Het
4932438A13Rik T A 3: 37,036,825 I743N probably damaging Het
Acot6 C A 12: 84,101,301 D110E probably benign Het
Agrn T A 4: 156,179,434 N124I probably benign Het
Astn1 G T 1: 158,600,389 G710V probably damaging Het
Bcar3 T C 3: 122,426,499 V15A probably benign Het
Best3 T C 10: 117,004,375 probably benign Het
Cenpa T C 5: 30,672,493 F39L possibly damaging Het
Cfap44 A T 16: 44,401,426 M1L probably benign Het
Chrnd A G 1: 87,194,819 I107M probably damaging Het
Col11a2 A G 17: 34,058,377 probably benign Het
Dnah10 G A 5: 124,812,723 probably null Het
Entpd8 A G 2: 25,084,769 Y404C probably damaging Het
Fam118a T C 15: 85,048,432 I125T possibly damaging Het
Fam129a T C 1: 151,718,084 V840A probably benign Het
Fam161a G A 11: 23,020,298 E159K possibly damaging Het
Frem2 A T 3: 53,519,954 Y2926N probably damaging Het
Gap43 A T 16: 42,292,328 D23E probably damaging Het
Glt8d1 T C 14: 31,006,504 F3S probably benign Het
Gm11555 C T 11: 99,650,018 probably benign Het
Gtpbp1 G A 15: 79,720,091 G667S probably damaging Het
H2-T24 A C 17: 36,015,571 S145R probably benign Het
Inpp5b A T 4: 124,795,456 N843I probably damaging Het
Jak3 C T 8: 71,686,976 probably benign Het
Krt8 T A 15: 102,001,448 M174L probably benign Het
Ktn1 C T 14: 47,663,941 T52I probably damaging Het
Lrp4 T C 2: 91,475,178 probably benign Het
Nefh G A 11: 4,940,240 A793V probably damaging Het
Notch1 A G 2: 26,466,572 S1678P probably benign Het
Notch2 C T 3: 98,102,451 probably benign Het
Nrxn3 T C 12: 88,795,342 F53S probably damaging Het
Olfr1346 A T 7: 6,474,235 I42F possibly damaging Het
Olfr146 G T 9: 39,019,176 R122S probably damaging Het
Olfr1504 C T 19: 13,887,752 V153I possibly damaging Het
Olfr209 T A 16: 59,361,808 N137Y probably damaging Het
Olfr324 A G 11: 58,597,848 I151V probably benign Het
Olfr961 A G 9: 39,646,872 T49A probably benign Het
Pak4 T A 7: 28,568,054 I62F possibly damaging Het
Pcdhb12 T A 18: 37,437,318 F506I probably damaging Het
Per1 A T 11: 69,104,190 D632V probably damaging Het
Plec A G 15: 76,177,298 M2678T probably benign Het
Plg A G 17: 12,411,447 probably benign Het
Prmt1 A T 7: 44,977,624 S304R probably damaging Het
Prr27 T C 5: 87,842,678 F50L probably benign Het
Prune2 T C 19: 17,006,753 L159P probably damaging Het
Ptpn12 A T 5: 20,998,483 N432K possibly damaging Het
Rfwd3 A G 8: 111,293,989 probably null Het
Rims2 A T 15: 39,567,030 D1170V probably damaging Het
Sag T C 1: 87,834,629 probably null Het
Sall4 C T 2: 168,756,336 A195T probably benign Het
Sbf2 G A 7: 110,367,323 probably benign Het
Scaper A T 9: 55,609,874 D599E possibly damaging Het
Sema7a G A 9: 57,960,593 S484N possibly damaging Het
Senp1 A G 15: 98,064,880 probably benign Het
Senp6 A G 9: 80,123,884 T623A probably damaging Het
Siae A G 9: 37,627,794 D95G probably benign Het
Slc26a2 T C 18: 61,198,379 D660G probably damaging Het
Slc3a1 T C 17: 85,028,649 F73S possibly damaging Het
Slfn5 A T 11: 82,961,040 Q664L probably damaging Het
Spire1 T C 18: 67,491,305 I512V probably damaging Het
Srpr A G 9: 35,213,501 T133A probably benign Het
Stag1 A G 9: 100,954,247 *175W probably null Het
Stk32c C A 7: 139,120,720 V316F probably damaging Het
Tekt1 A C 11: 72,345,594 N347K possibly damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnpo2 T A 8: 85,050,157 C498S probably damaging Het
Tra2b G A 16: 22,247,205 R281* probably null Het
Ubr5 A T 15: 37,991,344 I1985N probably benign Het
Ush2a T G 1: 188,443,181 S1159A probably benign Het
Vmn1r15 C T 6: 57,258,251 P35S probably benign Het
Vmn1r6 A T 6: 57,002,598 I60L probably benign Het
Vps8 A G 16: 21,459,811 probably benign Het
Xkr7 T C 2: 153,032,352 V113A possibly damaging Het
Other mutations in Fkbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Fkbp5 APN 17 28401046 utr 3 prime probably benign
IGL03104:Fkbp5 APN 17 28415972 missense probably damaging 1.00
R0242:Fkbp5 UTSW 17 28428452 missense probably benign 0.01
R0242:Fkbp5 UTSW 17 28428452 missense probably benign 0.01
R1557:Fkbp5 UTSW 17 28402755 missense probably damaging 0.96
R1853:Fkbp5 UTSW 17 28429307 missense possibly damaging 0.82
R2102:Fkbp5 UTSW 17 28406188 missense possibly damaging 0.81
R2194:Fkbp5 UTSW 17 28438027 missense probably benign 0.32
R3522:Fkbp5 UTSW 17 28415996 missense probably benign 0.00
R4959:Fkbp5 UTSW 17 28428369 missense probably damaging 1.00
R4973:Fkbp5 UTSW 17 28428369 missense probably damaging 1.00
R5164:Fkbp5 UTSW 17 28437990 critical splice donor site probably null
R6053:Fkbp5 UTSW 17 28428466 missense probably benign 0.00
R6443:Fkbp5 UTSW 17 28429279 missense probably damaging 1.00
R6989:Fkbp5 UTSW 17 28415945 missense probably benign 0.01
R7027:Fkbp5 UTSW 17 28412063 missense probably damaging 1.00
R7454:Fkbp5 UTSW 17 28416025 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCAACAGTTGCCTGGCTTCTC -3'
(R):5'- GTCCAGCAGTCCTTTGGCTAGTTC -3'

Sequencing Primer
(F):5'- CTCTTTGCACATCTATCTCTAGAAC -3'
(R):5'- ctgtctccgcagtgatcc -3'
Posted On2013-06-12