Incidental Mutation 'R0532:Scn1a'
ID49207
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Namesodium channel, voltage-gated, type I, alpha
SynonymsNav1.1
MMRRC Submission 038724-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0532 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66270778-66440840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66317823 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1126 (D1126V)
Ref Sequence ENSEMBL: ENSMUSP00000107990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000156865]
Predicted Effect probably damaging
Transcript: ENSMUST00000077489
AA Change: D1126V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: D1126V

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094951
AA Change: D1109V

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: D1109V

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112366
AA Change: D1137V

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: D1137V

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112371
AA Change: D1126V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: D1126V

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000156865
AA Change: D106V

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144633
Gene: ENSMUSG00000064329
AA Change: D106V

DomainStartEndE-ValueType
Pfam:Na_trans_assoc 1 182 2.2e-44 PFAM
Pfam:Ion_trans 186 462 1.3e-66 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000200839
AA Change: D41V
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,638,618 E339V possibly damaging Het
9230009I02Rik A T 11: 51,091,578 noncoding transcript Het
9230112D13Rik A T 14: 34,512,097 I79K unknown Het
Adam25 C T 8: 40,755,950 T751I probably benign Het
Adgrv1 C A 13: 81,578,896 V446L probably damaging Het
Afap1 C A 5: 35,968,600 A313D possibly damaging Het
Akap6 A G 12: 52,887,983 T753A probably benign Het
Aldh16a1 G T 7: 45,142,838 T730N probably damaging Het
Amfr A T 8: 93,999,108 M215K probably damaging Het
Apob A G 12: 8,016,188 R4386G possibly damaging Het
Arhgap45 A T 10: 80,022,083 M217L possibly damaging Het
Baiap2l2 C T 15: 79,284,076 E49K possibly damaging Het
Baz1a C T 12: 54,934,820 E350K possibly damaging Het
Bbx A T 16: 50,266,284 V83D probably damaging Het
Btaf1 T C 19: 36,951,186 probably benign Het
Cacna2d1 G A 5: 16,362,273 E942K probably benign Het
Cad T C 5: 31,062,187 probably benign Het
Ccdc96 A G 5: 36,486,366 K572R probably benign Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cep164 G A 9: 45,809,826 R93* probably null Het
Cir1 A G 2: 73,310,455 probably null Het
Crocc A G 4: 141,030,247 S912P possibly damaging Het
Cwf19l2 T C 9: 3,431,057 L463P probably benign Het
Cyp3a59 C T 5: 146,096,653 Q200* probably null Het
Cyp4b1 G T 4: 115,626,876 P303T probably damaging Het
Dcbld1 C A 10: 52,317,077 T306K probably benign Het
Dgat2 A G 7: 99,169,781 V56A possibly damaging Het
Dnajc16 A C 4: 141,789,009 L16R probably damaging Het
Dnmt1 A C 9: 20,918,556 probably benign Het
Dus3l A G 17: 56,769,308 I528V probably damaging Het
Egflam T C 15: 7,234,237 D744G probably benign Het
Epb41 A C 4: 131,978,795 probably benign Het
Eri2 C T 7: 119,785,983 V432I probably benign Het
Esyt2 A G 12: 116,357,198 probably benign Het
Extl3 A T 14: 65,077,673 M20K probably benign Het
Fam32a A G 8: 72,222,219 Y103C probably damaging Het
Fat4 T C 3: 38,981,721 V3174A probably benign Het
Fbxo40 T A 16: 36,969,622 E375D possibly damaging Het
Frrs1 A G 3: 116,883,164 T182A probably benign Het
Fry A G 5: 150,433,707 probably benign Het
Fry T C 5: 150,478,761 probably benign Het
Fsip2 A G 2: 82,977,785 I1483V probably benign Het
Glra3 T A 8: 56,125,076 D389E probably benign Het
Gpr3 A T 4: 133,210,485 I292N probably damaging Het
Grina T C 15: 76,248,845 M230T probably damaging Het
Igkv11-125 G A 6: 67,913,619 W16* probably null Het
Il18r1 T C 1: 40,474,901 V89A probably damaging Het
Ino80 T C 2: 119,381,983 E1286G possibly damaging Het
Iqch G A 9: 63,508,232 probably benign Het
Itpr2 G T 6: 146,112,400 Q2666K probably damaging Het
Kcnh3 A G 15: 99,232,963 D487G probably damaging Het
Kdm1a A G 4: 136,561,066 L402P probably damaging Het
Klhl10 T G 11: 100,447,111 probably benign Het
Krt39 T C 11: 99,514,791 T428A possibly damaging Het
Mapk3 G A 7: 126,763,386 probably benign Het
Med13l T A 5: 118,759,123 S2089T possibly damaging Het
Mex3c G A 18: 73,590,053 D406N possibly damaging Het
Mki67 G A 7: 135,698,164 R1714* probably null Het
Mmp9 C A 2: 164,949,820 S211* probably null Het
Nat8f2 G T 6: 85,867,802 Q193K probably benign Het
Olfr1333 T G 4: 118,829,700 T247P probably damaging Het
Olfr204 T C 16: 59,314,601 K269E probably benign Het
Omt2a C A 9: 78,312,905 A71S possibly damaging Het
Pdgfra G A 5: 75,170,773 V315I probably benign Het
Pdgfrb A G 18: 61,083,265 D1065G probably damaging Het
Pfas A T 11: 69,002,629 probably benign Het
Pramel5 T C 4: 144,272,740 E259G probably benign Het
Prpf6 A G 2: 181,622,211 Y222C possibly damaging Het
Rbck1 C A 2: 152,324,330 Q229H probably damaging Het
Rdm1 T A 11: 101,635,835 C278S probably benign Het
Sall1 T C 8: 89,033,191 D95G probably benign Het
Scn4a C T 11: 106,330,400 G811D probably benign Het
Sh2b1 A G 7: 126,472,272 I247T probably benign Het
Shprh C A 10: 11,162,812 T437K possibly damaging Het
Slc13a4 A T 6: 35,287,404 probably null Het
Slc16a1 C A 3: 104,653,418 Y346* probably null Het
Slc25a38 G T 9: 120,120,706 A163S probably damaging Het
Slc6a12 G A 6: 121,356,918 V238I probably damaging Het
Slc8b1 C A 5: 120,519,671 D66E probably damaging Het
Snapin A G 3: 90,489,586 L106P probably damaging Het
Tas2r122 G A 6: 132,711,828 S34F possibly damaging Het
Tiam2 A G 17: 3,421,646 K521R probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Ttc3 T C 16: 94,387,330 probably benign Het
Uba1y T C Y: 820,911 F31L probably benign Het
Ucp3 A G 7: 100,481,979 probably benign Het
Vcan T C 13: 89,703,772 E1023G probably damaging Het
Vmn2r45 A G 7: 8,471,821 I736T probably damaging Het
Vps36 T C 8: 22,218,245 F342L probably benign Het
Zc3hc1 A G 6: 30,374,930 probably benign Het
Zmym4 G A 4: 126,898,401 Q596* probably null Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66335531 critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66280793 missense probably damaging 1.00
IGL00658:Scn1a APN 2 66286038 missense probably damaging 1.00
IGL00823:Scn1a APN 2 66324935 missense probably benign 0.04
IGL00907:Scn1a APN 2 66327797 missense probably damaging 1.00
IGL01339:Scn1a APN 2 66325960 missense probably benign 0.09
IGL01401:Scn1a APN 2 66289111 missense probably damaging 1.00
IGL01503:Scn1a APN 2 66322343 missense probably damaging 1.00
IGL01575:Scn1a APN 2 66273236 missense probably damaging 1.00
IGL01598:Scn1a APN 2 66302485 missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66285937 missense probably damaging 1.00
IGL01796:Scn1a APN 2 66332301 splice site probably benign
IGL02079:Scn1a APN 2 66323360 missense probably benign 0.14
IGL02171:Scn1a APN 2 66273199 missense probably damaging 1.00
IGL02335:Scn1a APN 2 66277661 missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66326036 missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66351153 missense probably benign 0.01
IGL02507:Scn1a APN 2 66277813 missense probably damaging 1.00
IGL02646:Scn1a APN 2 66299618 splice site probably null
IGL02729:Scn1a APN 2 66299650 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66324762 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66318077 missense probably benign 0.00
IGL02752:Scn1a APN 2 66331412 missense probably damaging 1.00
IGL02815:Scn1a APN 2 66324858 missense probably damaging 1.00
IGL03163:Scn1a APN 2 66318074 missense probably benign 0.00
IGL03229:Scn1a APN 2 66299713 missense probably damaging 1.00
IGL03286:Scn1a APN 2 66277576 missense probably damaging 0.99
IGL03393:Scn1a APN 2 66318018 missense probably benign 0.19
PIT4791001:Scn1a UTSW 2 66273282 missense probably benign 0.18
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0107:Scn1a UTSW 2 66324633 missense probably benign 0.07
R0141:Scn1a UTSW 2 66289062 missense probably damaging 1.00
R0485:Scn1a UTSW 2 66273925 missense probably damaging 0.98
R0517:Scn1a UTSW 2 66302407 missense possibly damaging 0.88
R0746:Scn1a UTSW 2 66351126 missense probably benign 0.25
R0755:Scn1a UTSW 2 66321035 missense probably damaging 1.00
R0830:Scn1a UTSW 2 66299784 missense probably damaging 1.00
R0846:Scn1a UTSW 2 66324755 missense probably benign 0.43
R0918:Scn1a UTSW 2 66323307 splice site probably null
R1055:Scn1a UTSW 2 66337996 missense probably benign 0.08
R1432:Scn1a UTSW 2 66322429 missense probably damaging 1.00
R1497:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R1512:Scn1a UTSW 2 66331285 missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66319462 nonsense probably null
R1567:Scn1a UTSW 2 66273331 missense probably damaging 1.00
R1702:Scn1a UTSW 2 66318223 missense probably damaging 1.00
R1744:Scn1a UTSW 2 66322276 missense probably benign 0.06
R1834:Scn1a UTSW 2 66324616 missense probably benign 0.04
R1834:Scn1a UTSW 2 66324617 missense probably benign 0.00
R1860:Scn1a UTSW 2 66317982 missense probably damaging 0.99
R1871:Scn1a UTSW 2 66318025 missense probably damaging 0.98
R1909:Scn1a UTSW 2 66331352 missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66328425 missense probably damaging 1.00
R1976:Scn1a UTSW 2 66331271 missense probably benign 0.02
R2291:Scn1a UTSW 2 66288968 missense probably benign 0.44
R2302:Scn1a UTSW 2 66277745 missense probably damaging 1.00
R2367:Scn1a UTSW 2 66327679 missense probably damaging 1.00
R2418:Scn1a UTSW 2 66273843 missense probably damaging 0.98
R2517:Scn1a UTSW 2 66273832 missense probably damaging 1.00
R2568:Scn1a UTSW 2 66273469 missense probably damaging 1.00
R3083:Scn1a UTSW 2 66299637 missense probably damaging 1.00
R3903:Scn1a UTSW 2 66318132 missense probably benign 0.08
R3909:Scn1a UTSW 2 66273988 missense probably damaging 1.00
R3916:Scn1a UTSW 2 66277613 missense probably damaging 1.00
R3935:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R3936:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R4043:Scn1a UTSW 2 66326036 missense possibly damaging 0.60
R4429:Scn1a UTSW 2 66350985 missense possibly damaging 0.77
R4495:Scn1a UTSW 2 66280802 critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66350988 missense probably benign 0.23
R4834:Scn1a UTSW 2 66328522 nonsense probably null
R4873:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R4875:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66277801 missense probably damaging 1.00
R5255:Scn1a UTSW 2 66277669 missense probably damaging 0.99
R5435:Scn1a UTSW 2 66273534 missense probably damaging 1.00
R5449:Scn1a UTSW 2 66321002 missense probably damaging 0.96
R5519:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R5541:Scn1a UTSW 2 66324633 missense probably benign 0.07
R5556:Scn1a UTSW 2 66324797 missense probably benign 0.00
R5587:Scn1a UTSW 2 66273081 missense probably benign 0.01
R5972:Scn1a UTSW 2 66351110 missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66335456 missense probably damaging 1.00
R6195:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6233:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66273316 missense probably damaging 1.00
R6417:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6420:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6421:Scn1a UTSW 2 66272927 missense probably damaging 1.00
R6461:Scn1a UTSW 2 66326122 missense probably null 0.01
R6701:Scn1a UTSW 2 66337960 missense probably damaging 0.99
R6717:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R6834:Scn1a UTSW 2 66327742 missense probably damaging 1.00
R6918:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R6953:Scn1a UTSW 2 66319469 missense probably damaging 1.00
R6996:Scn1a UTSW 2 66287731 missense probably damaging 1.00
R7022:Scn1a UTSW 2 66317899 missense probably damaging 1.00
R7109:Scn1a UTSW 2 66350942 missense possibly damaging 0.62
R7115:Scn1a UTSW 2 66324618 nonsense probably null
R7239:Scn1a UTSW 2 66277656 intron probably null
R7434:Scn1a UTSW 2 66273045 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTACATGCTCTTAGCCAGCCAAAG -3'
(R):5'- AGATTGCTGTGGACAGGATGCAC -3'

Sequencing Primer
(F):5'- GCTGGTTGTTTttttcttttgttttg -3'
(R):5'- ATTGGGAAAGATCTGGACTGTC -3'
Posted On2013-06-12