Incidental Mutation 'R0533:Arpp21'
ID49326
Institutional Source Beutler Lab
Gene Symbol Arpp21
Ensembl Gene ENSMUSG00000032503
Gene Namecyclic AMP-regulated phosphoprotein, 21
SynonymsARPP-21, 0710001E13Rik, Tarpp, D9Bwg1012e, R3hdm3
MMRRC Submission 038725-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0533 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location112065091-112235938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112126505 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 522 (V522A)
Ref Sequence ENSEMBL: ENSMUSP00000125684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035085] [ENSMUST00000070218] [ENSMUST00000111872] [ENSMUST00000159246] [ENSMUST00000159451] [ENSMUST00000162065] [ENSMUST00000162097] [ENSMUST00000164754]
Predicted Effect probably benign
Transcript: ENSMUST00000035085
AA Change: V502A

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035085
Gene: ENSMUSG00000032503
AA Change: V502A

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 282 297 N/A INTRINSIC
low complexity region 348 368 N/A INTRINSIC
low complexity region 459 482 N/A INTRINSIC
low complexity region 490 503 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070218
AA Change: V522A

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000069264
Gene: ENSMUSG00000032503
AA Change: V522A

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111872
AA Change: V522A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107503
Gene: ENSMUSG00000032503
AA Change: V522A

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159246
SMART Domains Protein: ENSMUSP00000123715
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 260 274 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159432
Predicted Effect probably benign
Transcript: ENSMUST00000159451
SMART Domains Protein: ENSMUSP00000125095
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 233 248 N/A INTRINSIC
low complexity region 299 319 N/A INTRINSIC
low complexity region 410 433 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162065
AA Change: V522A

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125684
Gene: ENSMUSG00000032503
AA Change: V522A

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
low complexity region 302 317 N/A INTRINSIC
low complexity region 368 388 N/A INTRINSIC
low complexity region 479 502 N/A INTRINSIC
low complexity region 510 523 N/A INTRINSIC
low complexity region 662 677 N/A INTRINSIC
low complexity region 682 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162097
SMART Domains Protein: ENSMUSP00000124502
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164754
SMART Domains Protein: ENSMUSP00000125862
Gene: ENSMUSG00000032503

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 54 63 N/A INTRINSIC
low complexity region 101 122 N/A INTRINSIC
R3H 146 223 6.67e-16 SMART
Pfam:SUZ 244 298 3.4e-15 PFAM
low complexity region 335 350 N/A INTRINSIC
low complexity region 401 421 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 660 675 N/A INTRINSIC
low complexity region 680 692 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.5%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cAMP-regulated phosphoprotein. The encoded protein is enriched in the caudate nucleus and cerebellar cortex. A similar protein in mouse may be involved in regulating the effects of dopamine in the basal ganglia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mice are viable and display normal brain anatomy and no obvious behavioral or morphological defects. However, in medium spiny neurons from mutant mice, the ability of both M1 and D2 receptor activation to modulate L-type calcium channel currents is enhanced by nearly 2-fold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T G 8: 60,531,763 probably benign Het
Abcb1b A T 5: 8,864,113 probably null Het
Adcy10 A G 1: 165,564,023 N1283S probably benign Het
Adgrb1 T A 15: 74,541,559 W531R probably damaging Het
Ago4 A G 4: 126,516,860 V246A probably benign Het
Arid5b A T 10: 68,186,033 D242E probably damaging Het
Atg4b T A 1: 93,784,910 probably benign Het
Capn12 T C 7: 28,887,683 F359S possibly damaging Het
Ccdc88c A T 12: 100,954,282 I360N probably damaging Het
Clic3 A G 2: 25,458,138 Y99C probably damaging Het
Cux1 T C 5: 136,307,859 E925G probably damaging Het
Dnah10 G A 5: 124,775,250 probably null Het
Dnah17 A G 11: 118,110,537 V860A possibly damaging Het
Etv5 C T 16: 22,436,075 probably benign Het
Fam83a T A 15: 58,009,811 N345K probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm13089 G T 4: 143,698,020 C284* probably null Het
Gpm6a A G 8: 55,055,374 probably null Het
Grid1 T A 14: 35,309,385 Y312N possibly damaging Het
Gstm4 T C 3: 108,043,525 N51S probably benign Het
Hid1 A T 11: 115,348,809 I765N probably damaging Het
Hmmr A G 11: 40,709,989 V518A unknown Het
Itgb6 A G 2: 60,669,197 V84A probably benign Het
Kbtbd4 A G 2: 90,907,604 K233E probably benign Het
Kif15 A T 9: 123,009,433 probably benign Het
Klre1 T C 6: 129,583,193 S143P probably damaging Het
Krt81 T C 15: 101,461,389 D216G probably benign Het
Mctp2 G T 7: 72,080,822 H868Q probably benign Het
Morc2b G C 17: 33,135,932 Y955* probably null Het
Myog A C 1: 134,290,473 N140H possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neil3 A T 8: 53,638,775 probably null Het
Nrg1 T C 8: 31,831,245 probably null Het
Olfr681 G A 7: 105,122,350 V298I probably benign Het
Olfr689 A T 7: 105,314,372 M123L probably benign Het
Olfr99 A T 17: 37,280,291 L43* probably null Het
Pramef25 A T 4: 143,950,720 D96E possibly damaging Het
Ptger2 T A 14: 44,988,982 N6K possibly damaging Het
Ryr1 T A 7: 29,078,780 E2097V probably damaging Het
Sel1l A T 12: 91,820,094 F397Y probably damaging Het
Skint5 A G 4: 113,827,867 V551A unknown Het
Slc39a12 A G 2: 14,400,331 T245A probably benign Het
Syne1 C T 10: 5,358,438 V706I probably benign Het
Tbc1d8 G T 1: 39,372,774 Q994K possibly damaging Het
Tnrc6b C T 15: 80,876,653 T187I probably benign Het
Ttll6 G A 11: 96,154,756 A600T probably benign Het
Ust T C 10: 8,248,080 probably benign Het
Vmn2r71 GT GTT 7: 85,619,218 probably null Het
Vstm2a C T 11: 16,263,041 A142V probably damaging Het
Wfs1 T A 5: 36,973,722 probably benign Het
Wrap73 G A 4: 154,151,649 G145D probably damaging Het
Wrap73 G A 4: 154,156,154 V368M possibly damaging Het
Xrra1 T A 7: 99,875,145 probably null Het
Zfhx2 C T 14: 55,064,090 V2146I probably benign Het
Zfp335 A T 2: 164,907,922 L185* probably null Het
Other mutations in Arpp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Arpp21 APN 9 112176123 missense probably damaging 1.00
IGL02369:Arpp21 APN 9 112119198 missense probably benign
IGL02516:Arpp21 APN 9 112185661 missense probably damaging 1.00
IGL02687:Arpp21 APN 9 112065815 nonsense probably null
IGL02698:Arpp21 APN 9 112185744 utr 5 prime probably benign
IGL02948:Arpp21 APN 9 112176200 missense probably damaging 1.00
R0040:Arpp21 UTSW 9 112147409 splice site probably benign
R0636:Arpp21 UTSW 9 112183498 missense probably benign 0.30
R0696:Arpp21 UTSW 9 112183589 splice site probably null
R0707:Arpp21 UTSW 9 112157756 missense probably benign 0.25
R0970:Arpp21 UTSW 9 112136448 splice site probably benign
R1300:Arpp21 UTSW 9 112143374 missense probably damaging 1.00
R1416:Arpp21 UTSW 9 112179129 missense probably damaging 1.00
R1713:Arpp21 UTSW 9 112067169 missense probably damaging 1.00
R1803:Arpp21 UTSW 9 112127398 missense possibly damaging 0.61
R1884:Arpp21 UTSW 9 112143527 missense probably damaging 1.00
R1918:Arpp21 UTSW 9 112119178 splice site probably benign
R1992:Arpp21 UTSW 9 112157793 missense probably damaging 0.97
R2121:Arpp21 UTSW 9 112136670 missense probably damaging 1.00
R2932:Arpp21 UTSW 9 112179105 missense probably damaging 1.00
R3729:Arpp21 UTSW 9 112065979 missense possibly damaging 0.76
R3964:Arpp21 UTSW 9 112065776 missense probably damaging 1.00
R4130:Arpp21 UTSW 9 112155308 intron probably benign
R4131:Arpp21 UTSW 9 112155308 intron probably benign
R4514:Arpp21 UTSW 9 112177677 missense probably damaging 0.99
R4789:Arpp21 UTSW 9 112067292 missense probably benign 0.02
R5138:Arpp21 UTSW 9 112179084 missense probably damaging 1.00
R5218:Arpp21 UTSW 9 112143431 missense probably damaging 1.00
R5371:Arpp21 UTSW 9 112065932 missense probably benign 0.01
R5373:Arpp21 UTSW 9 112067268 missense probably benign
R5407:Arpp21 UTSW 9 112116753 intron probably benign
R5528:Arpp21 UTSW 9 112149353 missense probably benign 0.04
R5957:Arpp21 UTSW 9 112185686 missense probably benign 0.01
R5992:Arpp21 UTSW 9 112143485 nonsense probably null
R6166:Arpp21 UTSW 9 112119198 missense probably benign
R6294:Arpp21 UTSW 9 112127452 missense probably damaging 0.99
R6632:Arpp21 UTSW 9 112127356 nonsense probably null
R6952:Arpp21 UTSW 9 112126482 missense probably damaging 0.98
R7083:Arpp21 UTSW 9 112183544 missense probably benign 0.22
R7089:Arpp21 UTSW 9 112126446 missense probably benign 0.23
X0013:Arpp21 UTSW 9 112179160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGATGGATGCACACATGGATG -3'
(R):5'- GTCTGTAAGTTCAGAGCACCCAACC -3'

Sequencing Primer
(F):5'- tgagcacatctgcttgcc -3'
(R):5'- GACACTTCAAGGCAGGCTTTC -3'
Posted On2013-06-12