Incidental Mutation 'R0534:Reln'
ID 49358
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Name reelin
Synonyms
MMRRC Submission 038726-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R0534 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 22089452-22549700 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 22152406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2353 (D2353E)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000062372
AA Change: D2353E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: D2353E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084713
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: D2353E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: D2353E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162103
Meta Mutation Damage Score 0.1840 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cand2 A G 6: 115,764,197 (GRCm39) M324V probably damaging Het
Cap1 C T 4: 122,756,512 (GRCm39) V340M probably benign Het
Ccdc110 T C 8: 46,388,175 (GRCm39) V44A possibly damaging Het
Cps1 A G 1: 67,183,059 (GRCm39) D139G probably benign Het
Cwc27 T A 13: 104,768,124 (GRCm39) E457V unknown Het
Cxxc1 C T 18: 74,351,962 (GRCm39) P280S probably benign Het
Dennd2b A T 7: 109,140,635 (GRCm39) V197D probably damaging Het
Dop1b T A 16: 93,559,393 (GRCm39) L595Q probably benign Het
Dscam G T 16: 96,453,372 (GRCm39) S1292R possibly damaging Het
E2f4 C A 8: 106,030,851 (GRCm39) F353L probably damaging Het
Ep300 A G 15: 81,485,097 (GRCm39) probably benign Het
Fads1 C T 19: 10,160,429 (GRCm39) P5L probably benign Het
Fign T A 2: 63,811,135 (GRCm39) H45L probably damaging Het
Flcn T A 11: 59,685,025 (GRCm39) probably benign Het
Gm5141 A T 13: 62,922,408 (GRCm39) F254I probably damaging Het
Gpbp1l1 T A 4: 116,448,465 (GRCm39) N402K probably damaging Het
Gpr37 A T 6: 25,669,823 (GRCm39) C340* probably null Het
Gtf3c2 A T 5: 31,315,476 (GRCm39) probably benign Het
Hcfc2 T A 10: 82,574,242 (GRCm39) F139I probably damaging Het
Hectd4 T C 5: 121,486,539 (GRCm39) L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 44,986,659 (GRCm39) probably benign Het
Igf2bp1 A G 11: 95,857,622 (GRCm39) probably benign Het
Igsf9b T G 9: 27,244,358 (GRCm39) probably null Het
Il23r G A 6: 67,403,572 (GRCm39) A443V probably benign Het
Kcnv1 A G 15: 44,972,645 (GRCm39) F413L probably damaging Het
Lipe C A 7: 25,087,611 (GRCm39) A150S possibly damaging Het
Lrrcc1 T C 3: 14,622,333 (GRCm39) S557P probably damaging Het
Mrpl54 C A 10: 81,102,687 (GRCm39) W13L probably damaging Het
Mtcl3 T A 10: 29,056,952 (GRCm39) probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Npy1r C A 8: 67,157,670 (GRCm39) Q327K probably damaging Het
Nt5el C A 13: 105,218,762 (GRCm39) S32* probably null Het
Or51b17 C T 7: 103,542,438 (GRCm39) R168H probably benign Het
Osbpl10 C T 9: 114,996,246 (GRCm39) L139F probably damaging Het
P2rx6 A C 16: 17,385,768 (GRCm39) T199P probably damaging Het
Phyhip A T 14: 70,699,199 (GRCm39) M1L possibly damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Psmc1 T A 12: 100,086,389 (GRCm39) I342N possibly damaging Het
Rmdn3 T C 2: 118,976,851 (GRCm39) E294G probably benign Het
Scnn1g A G 7: 121,366,647 (GRCm39) M615V probably benign Het
Shcbp1l T A 1: 153,304,314 (GRCm39) D124E possibly damaging Het
Sipa1l1 T C 12: 82,472,054 (GRCm39) S1345P possibly damaging Het
Taf7l2 T C 10: 115,948,707 (GRCm39) E273G possibly damaging Het
Timp4 A G 6: 115,226,802 (GRCm39) Y114H probably damaging Het
Tlr9 T A 9: 106,102,086 (GRCm39) L459Q probably benign Het
Tmem104 C A 11: 115,091,654 (GRCm39) T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 112,207,172 (GRCm39) probably benign Het
Zfp622 A T 15: 25,984,654 (GRCm39) I7F possibly damaging Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL00091:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL00432:Reln APN 5 22,215,125 (GRCm39) missense probably damaging 1.00
IGL00433:Reln APN 5 22,250,007 (GRCm39) missense probably damaging 1.00
IGL00576:Reln APN 5 22,359,948 (GRCm39) missense probably benign 0.01
IGL00755:Reln APN 5 22,265,378 (GRCm39) missense probably damaging 0.98
IGL00777:Reln APN 5 22,223,848 (GRCm39) critical splice donor site probably null
IGL00900:Reln APN 5 22,185,115 (GRCm39) missense probably damaging 0.98
IGL01067:Reln APN 5 22,184,664 (GRCm39) missense probably damaging 1.00
IGL01104:Reln APN 5 22,191,965 (GRCm39) missense probably damaging 0.99
IGL01141:Reln APN 5 22,174,031 (GRCm39) missense probably damaging 1.00
IGL01141:Reln APN 5 22,124,067 (GRCm39) missense probably damaging 1.00
IGL01333:Reln APN 5 22,376,249 (GRCm39) missense probably damaging 0.99
IGL01341:Reln APN 5 22,174,077 (GRCm39) missense probably damaging 1.00
IGL01354:Reln APN 5 22,124,173 (GRCm39) nonsense probably null
IGL01361:Reln APN 5 22,124,019 (GRCm39) missense probably benign 0.06
IGL01446:Reln APN 5 22,174,315 (GRCm39) missense probably damaging 0.99
IGL01448:Reln APN 5 22,245,403 (GRCm39) missense probably benign 0.40
IGL01612:Reln APN 5 22,101,928 (GRCm39) missense probably damaging 0.99
IGL01695:Reln APN 5 22,125,436 (GRCm39) missense probably damaging 1.00
IGL01718:Reln APN 5 22,152,512 (GRCm39) missense possibly damaging 0.60
IGL01749:Reln APN 5 22,549,244 (GRCm39) nonsense probably null
IGL01875:Reln APN 5 22,109,715 (GRCm39) missense probably benign
IGL02013:Reln APN 5 22,155,877 (GRCm39) missense probably damaging 1.00
IGL02031:Reln APN 5 22,184,014 (GRCm39) missense probably damaging 0.99
IGL02186:Reln APN 5 22,114,956 (GRCm39) missense probably damaging 1.00
IGL02228:Reln APN 5 22,109,729 (GRCm39) missense probably damaging 0.99
IGL02248:Reln APN 5 22,115,990 (GRCm39) missense probably damaging 1.00
IGL02336:Reln APN 5 22,134,132 (GRCm39) missense probably damaging 1.00
IGL02352:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL02359:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL02376:Reln APN 5 22,285,789 (GRCm39) nonsense probably null
IGL02408:Reln APN 5 22,106,617 (GRCm39) missense probably benign 0.44
IGL02415:Reln APN 5 22,176,949 (GRCm39) missense possibly damaging 0.91
IGL02512:Reln APN 5 22,245,425 (GRCm39) missense probably benign 0.00
IGL02540:Reln APN 5 22,239,750 (GRCm39) missense probably damaging 0.96
IGL02624:Reln APN 5 22,308,355 (GRCm39) missense probably benign 0.09
IGL02720:Reln APN 5 22,202,939 (GRCm39) missense probably damaging 0.99
IGL02894:Reln APN 5 22,090,546 (GRCm39) missense possibly damaging 0.72
IGL02999:Reln APN 5 22,200,363 (GRCm39) missense probably damaging 1.00
IGL03125:Reln APN 5 22,115,842 (GRCm39) missense probably damaging 1.00
IGL03298:Reln APN 5 22,115,834 (GRCm39) missense probably damaging 0.99
Fishing UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
P0020:Reln UTSW 5 22,311,058 (GRCm39) missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22,491,894 (GRCm39) missense possibly damaging 0.71
R0018:Reln UTSW 5 22,130,369 (GRCm39) missense probably benign 0.01
R0105:Reln UTSW 5 22,253,813 (GRCm39) missense probably damaging 0.99
R0105:Reln UTSW 5 22,253,813 (GRCm39) missense probably damaging 0.99
R0127:Reln UTSW 5 22,209,134 (GRCm39) missense probably damaging 1.00
R0135:Reln UTSW 5 22,333,647 (GRCm39) missense probably damaging 0.99
R0144:Reln UTSW 5 22,153,447 (GRCm39) missense probably damaging 0.97
R0240:Reln UTSW 5 22,311,043 (GRCm39) missense probably benign 0.36
R0240:Reln UTSW 5 22,311,043 (GRCm39) missense probably benign 0.36
R0242:Reln UTSW 5 22,147,595 (GRCm39) critical splice donor site probably null
R0242:Reln UTSW 5 22,147,595 (GRCm39) critical splice donor site probably null
R0266:Reln UTSW 5 22,193,774 (GRCm39) missense probably damaging 1.00
R0269:Reln UTSW 5 22,125,535 (GRCm39) missense probably damaging 1.00
R0280:Reln UTSW 5 22,432,511 (GRCm39) splice site probably benign
R0333:Reln UTSW 5 22,134,240 (GRCm39) missense probably damaging 0.97
R0357:Reln UTSW 5 22,155,820 (GRCm39) missense probably damaging 1.00
R0359:Reln UTSW 5 22,253,798 (GRCm39) missense probably damaging 0.98
R0506:Reln UTSW 5 22,125,494 (GRCm39) missense probably damaging 0.97
R0535:Reln UTSW 5 22,256,274 (GRCm39) splice site probably benign
R0541:Reln UTSW 5 22,185,107 (GRCm39) missense possibly damaging 0.88
R0615:Reln UTSW 5 22,215,148 (GRCm39) missense probably benign 0.36
R0617:Reln UTSW 5 22,125,535 (GRCm39) missense probably damaging 1.00
R0634:Reln UTSW 5 22,223,867 (GRCm39) missense probably damaging 1.00
R0653:Reln UTSW 5 22,118,228 (GRCm39) missense probably benign 0.44
R0704:Reln UTSW 5 22,101,809 (GRCm39) missense probably damaging 0.99
R0706:Reln UTSW 5 22,101,809 (GRCm39) missense probably damaging 0.99
R0959:Reln UTSW 5 22,432,626 (GRCm39) missense probably damaging 0.96
R1066:Reln UTSW 5 22,239,662 (GRCm39) missense probably damaging 1.00
R1110:Reln UTSW 5 22,239,773 (GRCm39) missense probably benign
R1163:Reln UTSW 5 22,104,027 (GRCm39) missense probably benign 0.03
R1222:Reln UTSW 5 22,191,953 (GRCm39) missense probably null 0.97
R1226:Reln UTSW 5 22,115,864 (GRCm39) missense probably damaging 1.00
R1440:Reln UTSW 5 22,333,600 (GRCm39) splice site probably benign
R1532:Reln UTSW 5 22,239,742 (GRCm39) missense probably damaging 0.99
R1552:Reln UTSW 5 22,165,376 (GRCm39) missense probably benign 0.01
R1565:Reln UTSW 5 22,130,211 (GRCm39) missense probably benign 0.05
R1618:Reln UTSW 5 22,265,366 (GRCm39) missense probably benign 0.01
R1636:Reln UTSW 5 22,203,681 (GRCm39) missense probably damaging 0.99
R1664:Reln UTSW 5 22,134,084 (GRCm39) missense probably damaging 1.00
R1716:Reln UTSW 5 22,160,093 (GRCm39) missense probably damaging 0.98
R1759:Reln UTSW 5 22,215,287 (GRCm39) missense probably damaging 0.99
R1835:Reln UTSW 5 22,184,000 (GRCm39) missense probably damaging 1.00
R1907:Reln UTSW 5 22,249,960 (GRCm39) critical splice donor site probably null
R1991:Reln UTSW 5 22,174,358 (GRCm39) missense possibly damaging 0.56
R2046:Reln UTSW 5 22,147,625 (GRCm39) missense probably benign 0.01
R2072:Reln UTSW 5 22,124,175 (GRCm39) missense probably damaging 1.00
R2103:Reln UTSW 5 22,174,358 (GRCm39) missense possibly damaging 0.56
R2119:Reln UTSW 5 22,223,998 (GRCm39) missense probably damaging 1.00
R2120:Reln UTSW 5 22,174,083 (GRCm39) missense probably damaging 1.00
R2216:Reln UTSW 5 22,253,003 (GRCm39) missense probably benign 0.30
R2219:Reln UTSW 5 22,177,045 (GRCm39) missense possibly damaging 0.88
R2228:Reln UTSW 5 22,192,076 (GRCm39) missense possibly damaging 0.69
R2306:Reln UTSW 5 22,101,784 (GRCm39) missense probably damaging 1.00
R2316:Reln UTSW 5 22,359,954 (GRCm39) missense probably benign 0.00
R2321:Reln UTSW 5 22,120,018 (GRCm39) missense probably damaging 0.99
R2512:Reln UTSW 5 22,184,688 (GRCm39) missense possibly damaging 0.89
R2519:Reln UTSW 5 22,549,367 (GRCm39) missense unknown
R2870:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2870:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R3195:Reln UTSW 5 22,245,418 (GRCm39) missense possibly damaging 0.72
R3545:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3546:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3547:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3706:Reln UTSW 5 22,200,587 (GRCm39) splice site probably benign
R3713:Reln UTSW 5 22,109,732 (GRCm39) missense probably damaging 0.99
R3770:Reln UTSW 5 22,153,564 (GRCm39) missense probably damaging 1.00
R3836:Reln UTSW 5 22,116,012 (GRCm39) missense probably damaging 1.00
R3887:Reln UTSW 5 22,115,847 (GRCm39) missense possibly damaging 0.92
R3972:Reln UTSW 5 22,183,999 (GRCm39) missense probably damaging 0.99
R3975:Reln UTSW 5 22,200,364 (GRCm39) missense possibly damaging 0.57
R4022:Reln UTSW 5 22,432,628 (GRCm39) missense probably benign 0.45
R4044:Reln UTSW 5 22,333,630 (GRCm39) missense possibly damaging 0.82
R4107:Reln UTSW 5 22,239,582 (GRCm39) missense probably damaging 1.00
R4297:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4298:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4299:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4518:Reln UTSW 5 22,106,741 (GRCm39) missense probably benign 0.44
R4615:Reln UTSW 5 22,177,870 (GRCm39) missense possibly damaging 0.95
R4713:Reln UTSW 5 22,357,461 (GRCm39) missense probably benign 0.17
R4720:Reln UTSW 5 22,491,894 (GRCm39) missense possibly damaging 0.71
R4721:Reln UTSW 5 22,124,220 (GRCm39) missense probably damaging 0.99
R4771:Reln UTSW 5 22,254,698 (GRCm39) missense probably damaging 1.00
R4794:Reln UTSW 5 22,549,183 (GRCm39) missense probably damaging 0.98
R4840:Reln UTSW 5 22,223,844 (GRCm39) splice site probably null
R4860:Reln UTSW 5 22,106,749 (GRCm39) missense probably benign 0.06
R4860:Reln UTSW 5 22,106,749 (GRCm39) missense probably benign 0.06
R4896:Reln UTSW 5 22,160,236 (GRCm39) missense probably damaging 1.00
R4908:Reln UTSW 5 22,184,718 (GRCm39) missense probably benign 0.02
R4912:Reln UTSW 5 22,130,191 (GRCm39) missense probably benign 0.29
R4922:Reln UTSW 5 22,200,585 (GRCm39) critical splice acceptor site probably null
R4975:Reln UTSW 5 22,165,424 (GRCm39) missense probably damaging 1.00
R4976:Reln UTSW 5 22,176,868 (GRCm39) missense probably benign 0.05
R5020:Reln UTSW 5 22,239,636 (GRCm39) missense probably damaging 1.00
R5037:Reln UTSW 5 22,153,510 (GRCm39) missense probably damaging 1.00
R5082:Reln UTSW 5 22,101,075 (GRCm39) missense probably benign 0.00
R5119:Reln UTSW 5 22,176,868 (GRCm39) missense probably benign 0.05
R5125:Reln UTSW 5 22,118,239 (GRCm39) missense possibly damaging 0.78
R5137:Reln UTSW 5 22,160,179 (GRCm39) missense probably damaging 1.00
R5152:Reln UTSW 5 22,153,627 (GRCm39) missense probably damaging 1.00
R5154:Reln UTSW 5 22,193,763 (GRCm39) missense probably damaging 0.99
R5259:Reln UTSW 5 22,308,395 (GRCm39) missense possibly damaging 0.83
R5283:Reln UTSW 5 22,216,161 (GRCm39) missense probably damaging 1.00
R5386:Reln UTSW 5 22,244,527 (GRCm39) missense probably benign
R5400:Reln UTSW 5 22,184,712 (GRCm39) missense probably damaging 1.00
R5478:Reln UTSW 5 22,209,201 (GRCm39) missense probably benign 0.00
R5514:Reln UTSW 5 22,176,883 (GRCm39) missense possibly damaging 0.93
R5529:Reln UTSW 5 22,137,713 (GRCm39) missense possibly damaging 0.71
R5611:Reln UTSW 5 22,244,663 (GRCm39) nonsense probably null
R5648:Reln UTSW 5 22,203,570 (GRCm39) missense probably benign 0.04
R5649:Reln UTSW 5 22,106,623 (GRCm39) missense probably benign 0.33
R5744:Reln UTSW 5 22,311,081 (GRCm39) missense probably null 0.39
R5782:Reln UTSW 5 22,223,054 (GRCm39) missense probably benign 0.01
R5815:Reln UTSW 5 22,152,431 (GRCm39) missense probably damaging 0.99
R5838:Reln UTSW 5 22,104,111 (GRCm39) missense probably damaging 0.97
R6162:Reln UTSW 5 22,116,048 (GRCm39) missense probably damaging 1.00
R6219:Reln UTSW 5 22,153,594 (GRCm39) missense probably damaging 1.00
R6259:Reln UTSW 5 22,265,331 (GRCm39) missense probably damaging 0.99
R6279:Reln UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
R6299:Reln UTSW 5 22,491,942 (GRCm39) missense possibly damaging 0.71
R6300:Reln UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
R6314:Reln UTSW 5 22,357,482 (GRCm39) nonsense probably null
R6351:Reln UTSW 5 22,106,661 (GRCm39) nonsense probably null
R6369:Reln UTSW 5 22,256,359 (GRCm39) missense probably benign 0.03
R6371:Reln UTSW 5 22,200,511 (GRCm39) missense probably benign
R6374:Reln UTSW 5 22,285,712 (GRCm39) missense probably benign 0.06
R6425:Reln UTSW 5 22,116,018 (GRCm39) nonsense probably null
R6442:Reln UTSW 5 22,137,774 (GRCm39) missense probably benign
R6445:Reln UTSW 5 22,124,212 (GRCm39) missense probably benign 0.05
R6554:Reln UTSW 5 22,101,838 (GRCm39) missense probably damaging 1.00
R6641:Reln UTSW 5 22,134,132 (GRCm39) missense probably damaging 1.00
R6768:Reln UTSW 5 22,183,905 (GRCm39) missense probably damaging 0.99
R6859:Reln UTSW 5 22,239,568 (GRCm39) missense probably damaging 1.00
R6896:Reln UTSW 5 22,104,177 (GRCm39) missense probably benign 0.18
R6932:Reln UTSW 5 22,190,855 (GRCm39) missense probably benign 0.00
R6948:Reln UTSW 5 22,177,033 (GRCm39) missense probably damaging 1.00
R6959:Reln UTSW 5 22,181,562 (GRCm39) missense probably damaging 1.00
R7085:Reln UTSW 5 22,120,085 (GRCm39) nonsense probably null
R7091:Reln UTSW 5 22,104,027 (GRCm39) missense probably null 0.08
R7135:Reln UTSW 5 22,181,594 (GRCm39) missense possibly damaging 0.95
R7146:Reln UTSW 5 22,311,095 (GRCm39) missense probably damaging 0.97
R7167:Reln UTSW 5 22,147,618 (GRCm39) missense probably damaging 1.00
R7190:Reln UTSW 5 22,252,945 (GRCm39) missense probably damaging 1.00
R7256:Reln UTSW 5 22,183,921 (GRCm39) missense probably benign 0.03
R7393:Reln UTSW 5 22,181,349 (GRCm39) missense probably damaging 0.99
R7399:Reln UTSW 5 22,256,365 (GRCm39) missense probably damaging 0.99
R7400:Reln UTSW 5 22,176,932 (GRCm39) missense probably damaging 0.99
R7426:Reln UTSW 5 22,176,951 (GRCm39) missense probably damaging 1.00
R7463:Reln UTSW 5 22,308,433 (GRCm39) missense probably damaging 0.98
R7470:Reln UTSW 5 22,147,739 (GRCm39) missense probably damaging 0.99
R7473:Reln UTSW 5 22,134,125 (GRCm39) missense probably benign 0.25
R7501:Reln UTSW 5 22,432,636 (GRCm39) missense possibly damaging 0.91
R7542:Reln UTSW 5 22,160,179 (GRCm39) missense probably damaging 1.00
R7544:Reln UTSW 5 22,181,276 (GRCm39) nonsense probably null
R7588:Reln UTSW 5 22,090,566 (GRCm39) missense probably benign 0.03
R7631:Reln UTSW 5 22,176,933 (GRCm39) missense probably damaging 0.97
R7644:Reln UTSW 5 22,183,929 (GRCm39) missense probably benign 0.39
R7834:Reln UTSW 5 22,244,633 (GRCm39) missense possibly damaging 0.94
R7923:Reln UTSW 5 22,339,690 (GRCm39) missense probably benign 0.00
R7938:Reln UTSW 5 22,155,870 (GRCm39) missense probably damaging 0.97
R8006:Reln UTSW 5 22,104,082 (GRCm39) nonsense probably null
R8062:Reln UTSW 5 22,176,990 (GRCm39) missense probably benign 0.00
R8222:Reln UTSW 5 22,136,475 (GRCm39) nonsense probably null
R8266:Reln UTSW 5 22,223,085 (GRCm39) missense possibly damaging 0.62
R8267:Reln UTSW 5 22,209,110 (GRCm39) missense probably damaging 1.00
R8487:Reln UTSW 5 22,104,027 (GRCm39) missense probably benign 0.03
R8523:Reln UTSW 5 22,209,229 (GRCm39) missense probably damaging 1.00
R8751:Reln UTSW 5 22,147,672 (GRCm39) missense probably benign 0.37
R8801:Reln UTSW 5 22,155,854 (GRCm39) missense possibly damaging 0.94
R8802:Reln UTSW 5 22,130,257 (GRCm39) missense probably damaging 0.98
R8978:Reln UTSW 5 22,090,512 (GRCm39) missense possibly damaging 0.85
R8988:Reln UTSW 5 22,104,155 (GRCm39) missense probably damaging 0.97
R8995:Reln UTSW 5 22,184,577 (GRCm39) missense probably benign 0.00
R9022:Reln UTSW 5 22,181,613 (GRCm39) missense possibly damaging 0.66
R9042:Reln UTSW 5 22,253,036 (GRCm39) missense probably damaging 1.00
R9069:Reln UTSW 5 22,216,059 (GRCm39) missense probably damaging 1.00
R9089:Reln UTSW 5 22,130,198 (GRCm39) missense probably benign 0.01
R9126:Reln UTSW 5 22,160,194 (GRCm39) missense probably damaging 1.00
R9172:Reln UTSW 5 22,155,815 (GRCm39) critical splice donor site probably null
R9182:Reln UTSW 5 22,106,617 (GRCm39) missense probably benign 0.44
R9196:Reln UTSW 5 22,357,471 (GRCm39) missense probably damaging 1.00
R9211:Reln UTSW 5 22,549,200 (GRCm39) nonsense probably null
R9241:Reln UTSW 5 22,174,067 (GRCm39) missense probably damaging 0.99
R9244:Reln UTSW 5 22,120,151 (GRCm39) missense probably damaging 0.99
R9281:Reln UTSW 5 22,153,545 (GRCm39) missense probably damaging 1.00
R9295:Reln UTSW 5 22,209,209 (GRCm39) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,193,705 (GRCm39) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,285,689 (GRCm39) missense probably benign 0.01
R9309:Reln UTSW 5 22,176,866 (GRCm39) missense probably benign 0.37
R9338:Reln UTSW 5 22,202,937 (GRCm39) missense probably damaging 0.98
R9381:Reln UTSW 5 22,549,202 (GRCm39) missense possibly damaging 0.93
R9430:Reln UTSW 5 22,120,105 (GRCm39) missense probably damaging 1.00
R9509:Reln UTSW 5 22,549,198 (GRCm39) missense possibly damaging 0.93
R9515:Reln UTSW 5 22,125,508 (GRCm39) missense possibly damaging 0.46
R9717:Reln UTSW 5 22,136,427 (GRCm39) missense probably benign 0.26
R9745:Reln UTSW 5 22,152,525 (GRCm39) missense probably damaging 1.00
R9778:Reln UTSW 5 22,155,943 (GRCm39) missense probably damaging 1.00
Z1176:Reln UTSW 5 22,184,022 (GRCm39) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,209,080 (GRCm39) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,174,239 (GRCm39) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,432,634 (GRCm39) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,359,957 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTGACACAGGTTCCAAACAGTCCC -3'
(R):5'- GACATGTGCTTTCCAATGGCACAG -3'

Sequencing Primer
(F):5'- GTTCCAAACAGTCCCACTGC -3'
(R):5'- TCCAATGGCACAGTTTGGC -3'
Posted On 2013-06-12