Incidental Mutation 'R0534:Cand2'
ID49364
Institutional Source Beutler Lab
Gene Symbol Cand2
Ensembl Gene ENSMUSG00000030319
Gene Namecullin-associated and neddylation-dissociated 2 (putative)
Synonyms2210404G23Rik, Tp120b
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0534 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location115774538-115805557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115787236 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 324 (M324V)
Ref Sequence ENSEMBL: ENSMUSP00000075377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075995]
Predicted Effect probably damaging
Transcript: ENSMUST00000075995
AA Change: M324V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075377
Gene: ENSMUSG00000030319
AA Change: M324V

DomainStartEndE-ValueType
low complexity region 325 347 N/A INTRINSIC
low complexity region 536 548 N/A INTRINSIC
low complexity region 553 562 N/A INTRINSIC
low complexity region 665 686 N/A INTRINSIC
low complexity region 736 748 N/A INTRINSIC
Pfam:HEAT 861 890 4.4e-5 PFAM
Pfam:TIP120 1044 1209 6e-64 PFAM
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Cand2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Cand2 APN 6 115785125 missense probably benign
IGL01329:Cand2 APN 6 115782794 missense probably benign 0.43
IGL01777:Cand2 APN 6 115792857 missense probably damaging 0.99
IGL02008:Cand2 APN 6 115803638 missense probably damaging 1.00
IGL02185:Cand2 APN 6 115789510 missense probably benign 0.01
IGL02219:Cand2 APN 6 115803812 missense probably damaging 1.00
IGL02240:Cand2 APN 6 115803662 missense probably damaging 1.00
IGL02329:Cand2 APN 6 115789607 missense probably damaging 1.00
IGL02396:Cand2 APN 6 115791188 splice site probably benign
IGL02893:Cand2 APN 6 115791960 missense probably damaging 1.00
IGL03161:Cand2 APN 6 115792737 missense probably benign 0.45
IGL03170:Cand2 APN 6 115797900 missense probably damaging 1.00
IGL03257:Cand2 APN 6 115799983 missense possibly damaging 0.80
succor UTSW 6 115791192 missense probably damaging 1.00
R0196:Cand2 UTSW 6 115789502 missense probably damaging 1.00
R0390:Cand2 UTSW 6 115774653 missense possibly damaging 0.90
R0630:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0631:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0662:Cand2 UTSW 6 115787210 missense probably benign 0.00
R0671:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0708:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0849:Cand2 UTSW 6 115792391 missense probably damaging 1.00
R1992:Cand2 UTSW 6 115785132 missense possibly damaging 0.88
R3428:Cand2 UTSW 6 115789707 missense probably benign
R3773:Cand2 UTSW 6 115785217 missense probably damaging 0.96
R4329:Cand2 UTSW 6 115799988 missense possibly damaging 0.64
R4489:Cand2 UTSW 6 115789466 missense probably damaging 1.00
R4553:Cand2 UTSW 6 115792211 missense probably damaging 1.00
R4577:Cand2 UTSW 6 115791259 missense probably damaging 1.00
R4634:Cand2 UTSW 6 115797987 missense probably damaging 1.00
R4850:Cand2 UTSW 6 115801948 missense probably benign 0.14
R5155:Cand2 UTSW 6 115792258 missense probably benign 0.42
R5190:Cand2 UTSW 6 115789513 missense probably damaging 1.00
R5378:Cand2 UTSW 6 115801951 missense probably benign 0.00
R5407:Cand2 UTSW 6 115785200 missense possibly damaging 0.76
R5698:Cand2 UTSW 6 115791743 missense probably damaging 1.00
R5701:Cand2 UTSW 6 115797932 missense probably damaging 0.99
R6172:Cand2 UTSW 6 115791310 missense probably benign 0.00
R6763:Cand2 UTSW 6 115799969 missense probably benign 0.00
R6920:Cand2 UTSW 6 115791289 missense possibly damaging 0.93
R7229:Cand2 UTSW 6 115791192 missense probably damaging 1.00
R7520:Cand2 UTSW 6 115785251 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGAGCTAAGAGAGTCCTGCCTCC -3'
(R):5'- ATGACTGCACTGCCTTCCCTACAG -3'

Sequencing Primer
(F):5'- CCTTCCTAAGAAAGTAAGTGTGGC -3'
(R):5'- TTCCCTACAGCTAGAGAAGAGC -3'
Posted On2013-06-12