Mutagenetix > Incidental Mutation

Incidental Mutation 'R0534:E2f4'

49371

Institutional Source

Beutler Lab

Gene Symbol

E2f4

Ensembl Gene

ENSMUSG00000014859

Gene Name

E2F transcription factor 4

Synonyms

2010111M04Rik

MMRRC Submission

038726-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0534 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106024295-106032002 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 106030851 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 353 (F353L)

Ref Sequence

ENSEMBL: ENSMUSP00000015003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015003] [ENSMUST00000109375] [ENSMUST00000212033] [ENSMUST00000212046]

AlphaFold

Q8R0K9

Predicted Effect

probably damaging
Transcript: ENSMUST00000015003
AA Change: F353L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859
AA Change: F353L

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
E2F_TDP	17	83	3.56e-31	SMART
Pfam:E2F_CC-MB	100	196	2.8e-36	PFAM
low complexity region	201	252	N/A	INTRINSIC
low complexity region	360	372	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000093622

Predicted Effect

probably benign
Transcript: ENSMUST00000109375

SMART Domains

Protein: ENSMUSP00000105000
Gene: ENSMUSG00000014791

Domain	Start	End	E-Value	Type
Pfam:DUF3361	115	268	3.8e-55	PFAM
Pfam:ELMO_CED12	291	468	1.1e-42	PFAM
PH	542	665	2.17e0	SMART
low complexity region	694	706	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184892

Predicted Effect

probably benign
Transcript: ENSMUST00000212033

Predicted Effect

probably benign
Transcript: ENSMUST00000212046

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212345

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212572

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212655

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die postnatally of an increased susceptibility to bacterial infection and exhibit craniofacial defects, erythroid abnormalities, and growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cand2	A	G	6: 115,764,197 (GRCm39)	M324V	probably damaging	Het
Cap1	C	T	4: 122,756,512 (GRCm39)	V340M	probably benign	Het
Ccdc110	T	C	8: 46,388,175 (GRCm39)	V44A	possibly damaging	Het
Cps1	A	G	1: 67,183,059 (GRCm39)	D139G	probably benign	Het
Cwc27	T	A	13: 104,768,124 (GRCm39)	E457V	unknown	Het
Cxxc1	C	T	18: 74,351,962 (GRCm39)	P280S	probably benign	Het
Dennd2b	A	T	7: 109,140,635 (GRCm39)	V197D	probably damaging	Het
Dop1b	T	A	16: 93,559,393 (GRCm39)	L595Q	probably benign	Het
Dscam	G	T	16: 96,453,372 (GRCm39)	S1292R	possibly damaging	Het
Ep300	A	G	15: 81,485,097 (GRCm39)		probably benign	Het
Fads1	C	T	19: 10,160,429 (GRCm39)	P5L	probably benign	Het
Fign	T	A	2: 63,811,135 (GRCm39)	H45L	probably damaging	Het
Flcn	T	A	11: 59,685,025 (GRCm39)		probably benign	Het
Gm5141	A	T	13: 62,922,408 (GRCm39)	F254I	probably damaging	Het
Gpbp1l1	T	A	4: 116,448,465 (GRCm39)	N402K	probably damaging	Het
Gpr37	A	T	6: 25,669,823 (GRCm39)	C340*	probably null	Het
Gtf3c2	A	T	5: 31,315,476 (GRCm39)		probably benign	Het
Hcfc2	T	A	10: 82,574,242 (GRCm39)	F139I	probably damaging	Het
Hectd4	T	C	5: 121,486,539 (GRCm39)	L3178P	possibly damaging	Het
Hrc	AGAGGAGGAGGAAGAGGAGGAGGA	AGAGGAGGAGGAGGAAGAGGAGGAGGA	7: 44,986,659 (GRCm39)		probably benign	Het
Igf2bp1	A	G	11: 95,857,622 (GRCm39)		probably benign	Het
Igsf9b	T	G	9: 27,244,358 (GRCm39)		probably null	Het
Il23r	G	A	6: 67,403,572 (GRCm39)	A443V	probably benign	Het
Kcnv1	A	G	15: 44,972,645 (GRCm39)	F413L	probably damaging	Het
Lipe	C	A	7: 25,087,611 (GRCm39)	A150S	possibly damaging	Het
Lrrcc1	T	C	3: 14,622,333 (GRCm39)	S557P	probably damaging	Het
Mrpl54	C	A	10: 81,102,687 (GRCm39)	W13L	probably damaging	Het
Mtcl3	T	A	10: 29,056,952 (GRCm39)		probably benign	Het
Myrf	G	C	19: 10,195,526 (GRCm39)	T428S	probably benign	Het
Npy1r	C	A	8: 67,157,670 (GRCm39)	Q327K	probably damaging	Het
Nt5el	C	A	13: 105,218,762 (GRCm39)	S32*	probably null	Het
Or51b17	C	T	7: 103,542,438 (GRCm39)	R168H	probably benign	Het
Osbpl10	C	T	9: 114,996,246 (GRCm39)	L139F	probably damaging	Het
P2rx6	A	C	16: 17,385,768 (GRCm39)	T199P	probably damaging	Het
Phyhip	A	T	14: 70,699,199 (GRCm39)	M1L	possibly damaging	Het
Pkd1l3	C	G	8: 110,350,281 (GRCm39)	D375E	possibly damaging	Het
Psmc1	T	A	12: 100,086,389 (GRCm39)	I342N	possibly damaging	Het
Reln	A	T	5: 22,152,406 (GRCm39)	D2353E	probably damaging	Het
Rmdn3	T	C	2: 118,976,851 (GRCm39)	E294G	probably benign	Het
Scnn1g	A	G	7: 121,366,647 (GRCm39)	M615V	probably benign	Het
Shcbp1l	T	A	1: 153,304,314 (GRCm39)	D124E	possibly damaging	Het
Sipa1l1	T	C	12: 82,472,054 (GRCm39)	S1345P	possibly damaging	Het
Taf7l2	T	C	10: 115,948,707 (GRCm39)	E273G	possibly damaging	Het
Timp4	A	G	6: 115,226,802 (GRCm39)	Y114H	probably damaging	Het
Tlr9	T	A	9: 106,102,086 (GRCm39)	L459Q	probably benign	Het
Tmem104	C	A	11: 115,091,654 (GRCm39)	T59K	probably damaging	Het
Wdr59	GGGTGGTG	GGGTG	8: 112,207,172 (GRCm39)		probably benign	Het
Zfp622	A	T	15: 25,984,654 (GRCm39)	I7F	possibly damaging	Het

Other mutations in E2f4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:E2f4	APN	8	106,030,809 (GRCm39)	unclassified	probably benign
IGL01642:E2f4	APN	8	106,027,968 (GRCm39)	missense	probably damaging	1.00
R0488:E2f4	UTSW	8	106,025,171 (GRCm39)	missense	probably damaging	0.97
R0835:E2f4	UTSW	8	106,027,140 (GRCm39)	nonsense	probably null
R1548:E2f4	UTSW	8	106,031,320 (GRCm39)	makesense	probably null
R2120:E2f4	UTSW	8	106,026,973 (GRCm39)	missense	probably damaging	1.00
R2233:E2f4	UTSW	8	106,025,283 (GRCm39)	missense	probably damaging	1.00
R2235:E2f4	UTSW	8	106,025,283 (GRCm39)	missense	probably damaging	1.00
R7369:E2f4	UTSW	8	106,026,966 (GRCm39)	missense	probably benign	0.00
R7731:E2f4	UTSW	8	106,025,265 (GRCm39)	missense	probably damaging	0.99
R8265:E2f4	UTSW	8	106,027,977 (GRCm39)	missense	probably damaging	1.00
R8293:E2f4	UTSW	8	106,024,451 (GRCm39)	missense	probably damaging	0.98
R9283:E2f4	UTSW	8	106,024,395 (GRCm39)	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- TTGGCTCAGCATCGAAGAATGTAGG -3'
(R):5'- AGCTCATGCACTCTGGGAATGAAC -3'

Sequencing Primer
(F):5'- GCATCGAAGAATGTAGGTCAGC -3'
(R):5'- ACACAATTCATTCAGATTCTGGCTC -3'

Posted On

2013-06-12