Incidental Mutation 'R0534:E2f4'
ID49371
Institutional Source Beutler Lab
Gene Symbol E2f4
Ensembl Gene ENSMUSG00000014859
Gene NameE2F transcription factor 4
Synonyms
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0534 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105297663-105305370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105304219 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 353 (F353L)
Ref Sequence ENSEMBL: ENSMUSP00000015003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015003] [ENSMUST00000109375] [ENSMUST00000212033] [ENSMUST00000212046]
Predicted Effect probably damaging
Transcript: ENSMUST00000015003
AA Change: F353L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093622
Predicted Effect probably benign
Transcript: ENSMUST00000109375
SMART Domains Protein: ENSMUSP00000105000
Gene: ENSMUSG00000014791

DomainStartEndE-ValueType
Pfam:DUF3361 115 268 3.8e-55 PFAM
Pfam:ELMO_CED12 291 468 1.1e-42 PFAM
PH 542 665 2.17e0 SMART
low complexity region 694 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184892
Predicted Effect probably benign
Transcript: ENSMUST00000212033
Predicted Effect probably benign
Transcript: ENSMUST00000212046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212655
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die postnatally of an increased susceptibility to bacterial infection and exhibit craniofacial defects, erythroid abnormalities, and growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in E2f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:E2f4 APN 8 105304177 unclassified probably benign
IGL01642:E2f4 APN 8 105301336 missense probably damaging 1.00
R0488:E2f4 UTSW 8 105298539 missense probably damaging 0.97
R0835:E2f4 UTSW 8 105300508 nonsense probably null
R1548:E2f4 UTSW 8 105304688 makesense probably null
R2120:E2f4 UTSW 8 105300341 missense probably damaging 1.00
R2233:E2f4 UTSW 8 105298651 missense probably damaging 1.00
R2235:E2f4 UTSW 8 105298651 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCTCAGCATCGAAGAATGTAGG -3'
(R):5'- AGCTCATGCACTCTGGGAATGAAC -3'

Sequencing Primer
(F):5'- GCATCGAAGAATGTAGGTCAGC -3'
(R):5'- ACACAATTCATTCAGATTCTGGCTC -3'
Posted On2013-06-12