Incidental Mutation 'R0535:Cyp51'
ID49406
Institutional Source Beutler Lab
Gene Symbol Cyp51
Ensembl Gene ENSMUSG00000001467
Gene Namecytochrome P450, family 51
Synonyms
MMRRC Submission 038727-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0535 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location4081145-4104746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4099202 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 225 (Q225R)
Ref Sequence ENSEMBL: ENSMUSP00000001507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001507]
Predicted Effect probably benign
Transcript: ENSMUST00000001507
AA Change: Q225R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000001507
Gene: ENSMUSG00000001467
AA Change: Q225R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:p450 61 496 1.9e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199909
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein participates in the synthesis of cholesterol by catalyzing the removal of the 14alpha-methyl group from lanosterol. Homologous genes are found in all three eukaryotic phyla, fungi, plants, and animals, suggesting that this is one of the oldest cytochrome P450 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit skeletal and craniofacial abnormalities and die at late midgestation due to heart failure resulting from cardiac hypoplasia, ventricle septum, epicardial and vasculogenesis defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,748,181 F118S possibly damaging Het
Aatk A G 11: 120,010,193 S1069P probably benign Het
Acmsd A T 1: 127,765,943 I305L probably benign Het
Aco2 G A 15: 81,913,217 E625K possibly damaging Het
Acox1 G A 11: 116,174,438 T561I possibly damaging Het
Acox2 T A 14: 8,256,753 T37S probably damaging Het
Apc A T 18: 34,261,072 K17M probably damaging Het
BC027072 A G 17: 71,752,439 V81A probably benign Het
Cant1 T C 11: 118,411,143 D116G probably damaging Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
E2f8 T C 7: 48,871,810 probably benign Het
Fam163b T C 2: 27,112,766 Y73C probably benign Het
Fbxw9 T C 8: 85,064,600 C271R probably damaging Het
Gbp10 T C 5: 105,221,011 N321D possibly damaging Het
Gle1 T C 2: 29,957,805 F675L probably damaging Het
Gm6327 T C 16: 12,760,377 noncoding transcript Het
Gphn T A 12: 78,492,050 F157I possibly damaging Het
Gtpbp1 A T 15: 79,707,732 T94S probably damaging Het
Hdac2 T C 10: 36,993,899 F286L probably benign Het
Ighv3-6 A T 12: 114,288,470 probably benign Het
Itga2b A G 11: 102,457,533 V791A possibly damaging Het
Itgb4 A T 11: 115,991,009 I796F possibly damaging Het
Kel T C 6: 41,690,838 K390R probably null Het
Krt42 C T 11: 100,264,586 C368Y probably damaging Het
Lancl1 A G 1: 67,009,906 probably benign Het
Lipg A G 18: 74,954,220 Y177H probably damaging Het
Lnpep T C 17: 17,571,673 E402G possibly damaging Het
Ltbp2 A T 12: 84,784,858 I1727N probably damaging Het
Ltbp2 A G 12: 84,791,052 F1185L probably damaging Het
Mettl22 T C 16: 8,484,346 probably benign Het
Mug1 G A 6: 121,851,454 G275E probably benign Het
Nell2 T A 15: 95,431,607 T278S probably benign Het
Nomo1 T A 7: 46,072,517 S961T probably damaging Het
Olfr992 A G 2: 85,400,095 L146P possibly damaging Het
Phf2 A G 13: 48,813,947 Y675H unknown Het
Phldb2 A G 16: 45,757,127 V1145A probably damaging Het
Phrf1 T C 7: 141,260,065 S1058P probably benign Het
Prss3 T C 6: 41,374,969 N120S probably benign Het
Reln G T 5: 22,051,276 probably benign Het
Soga1 T C 2: 157,033,289 E847G possibly damaging Het
Spag5 A G 11: 78,304,728 Y287C probably benign Het
Syde2 G A 3: 145,989,170 probably null Het
Synj1 C A 16: 90,948,087 V1190F possibly damaging Het
Taok1 A T 11: 77,553,704 I515N probably benign Het
Tmem259 A T 10: 79,978,595 V309E probably damaging Het
Tmem62 T A 2: 121,002,596 V494E possibly damaging Het
Trak1 A T 9: 121,443,712 E119V probably null Het
Vmn1r1 T A 1: 182,157,951 I50L probably benign Het
Xpc C T 6: 91,504,578 V254I possibly damaging Het
Zfp58 G A 13: 67,492,082 Q97* probably null Het
Zscan5b A G 7: 6,233,912 E220G possibly damaging Het
Other mutations in Cyp51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Cyp51 APN 5 4083247 missense probably damaging 1.00
IGL02047:Cyp51 APN 5 4099244 missense possibly damaging 0.86
IGL02191:Cyp51 APN 5 4100147 missense probably benign 0.05
IGL02492:Cyp51 APN 5 4104304 missense probably benign 0.01
IGL03209:Cyp51 APN 5 4104195 missense probably damaging 1.00
PIT4515001:Cyp51 UTSW 5 4099122 critical splice donor site probably null
PIT4520001:Cyp51 UTSW 5 4101200 missense probably damaging 1.00
R2048:Cyp51 UTSW 5 4086636 splice site probably benign
R2165:Cyp51 UTSW 5 4086594 missense probably damaging 1.00
R2851:Cyp51 UTSW 5 4099183 missense probably damaging 1.00
R3975:Cyp51 UTSW 5 4091877 missense probably damaging 0.97
R4799:Cyp51 UTSW 5 4083256 missense probably damaging 1.00
R5699:Cyp51 UTSW 5 4101213 missense probably damaging 1.00
R6163:Cyp51 UTSW 5 4100199 missense probably damaging 1.00
R6484:Cyp51 UTSW 5 4086627 missense probably benign 0.07
R7046:Cyp51 UTSW 5 4100188 missense probably damaging 1.00
R7155:Cyp51 UTSW 5 4087846 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAATGGAAGCTCCTGATGTGCCC -3'
(R):5'- GTCTAAAGCAAAACTGTGAAGCGCC -3'

Sequencing Primer
(F):5'- CTGATGTGCCCAAATTAGGAAGC -3'
(R):5'- GTTTGAAGCACTGTCTGAGCT -3'
Posted On2013-06-12