Incidental Mutation 'R0535:Gbp10'
ID49408
Institutional Source Beutler Lab
Gene Symbol Gbp10
Ensembl Gene ENSMUSG00000105096
Gene Nameguanylate-binding protein 10
Synonyms
MMRRC Submission 038727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0535 (G1)
Quality Score160
Status Not validated
Chromosome5
Chromosomal Location105215699-105239533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105221011 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 321 (N321D)
Ref Sequence ENSEMBL: ENSMUSP00000069042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000065588]
Predicted Effect probably benign
Transcript: ENSMUST00000050011
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000065588
AA Change: N321D

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069042
Gene: ENSMUSG00000105096
AA Change: N321D

DomainStartEndE-ValueType
Pfam:GBP 16 279 5e-115 PFAM
Pfam:GBP_C 281 575 3.6e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196634
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,748,181 F118S possibly damaging Het
Aatk A G 11: 120,010,193 S1069P probably benign Het
Acmsd A T 1: 127,765,943 I305L probably benign Het
Aco2 G A 15: 81,913,217 E625K possibly damaging Het
Acox1 G A 11: 116,174,438 T561I possibly damaging Het
Acox2 T A 14: 8,256,753 T37S probably damaging Het
Apc A T 18: 34,261,072 K17M probably damaging Het
BC027072 A G 17: 71,752,439 V81A probably benign Het
Cant1 T C 11: 118,411,143 D116G probably damaging Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Cyp51 T C 5: 4,099,202 Q225R probably benign Het
E2f8 T C 7: 48,871,810 probably benign Het
Fam163b T C 2: 27,112,766 Y73C probably benign Het
Fbxw9 T C 8: 85,064,600 C271R probably damaging Het
Gle1 T C 2: 29,957,805 F675L probably damaging Het
Gm6327 T C 16: 12,760,377 noncoding transcript Het
Gphn T A 12: 78,492,050 F157I possibly damaging Het
Gtpbp1 A T 15: 79,707,732 T94S probably damaging Het
Hdac2 T C 10: 36,993,899 F286L probably benign Het
Ighv3-6 A T 12: 114,288,470 probably benign Het
Itga2b A G 11: 102,457,533 V791A possibly damaging Het
Itgb4 A T 11: 115,991,009 I796F possibly damaging Het
Kel T C 6: 41,690,838 K390R probably null Het
Krt42 C T 11: 100,264,586 C368Y probably damaging Het
Lancl1 A G 1: 67,009,906 probably benign Het
Lipg A G 18: 74,954,220 Y177H probably damaging Het
Lnpep T C 17: 17,571,673 E402G possibly damaging Het
Ltbp2 A T 12: 84,784,858 I1727N probably damaging Het
Ltbp2 A G 12: 84,791,052 F1185L probably damaging Het
Mettl22 T C 16: 8,484,346 probably benign Het
Mug1 G A 6: 121,851,454 G275E probably benign Het
Nell2 T A 15: 95,431,607 T278S probably benign Het
Nomo1 T A 7: 46,072,517 S961T probably damaging Het
Olfr992 A G 2: 85,400,095 L146P possibly damaging Het
Phf2 A G 13: 48,813,947 Y675H unknown Het
Phldb2 A G 16: 45,757,127 V1145A probably damaging Het
Phrf1 T C 7: 141,260,065 S1058P probably benign Het
Prss3 T C 6: 41,374,969 N120S probably benign Het
Reln G T 5: 22,051,276 probably benign Het
Soga1 T C 2: 157,033,289 E847G possibly damaging Het
Spag5 A G 11: 78,304,728 Y287C probably benign Het
Syde2 G A 3: 145,989,170 probably null Het
Synj1 C A 16: 90,948,087 V1190F possibly damaging Het
Taok1 A T 11: 77,553,704 I515N probably benign Het
Tmem259 A T 10: 79,978,595 V309E probably damaging Het
Tmem62 T A 2: 121,002,596 V494E possibly damaging Het
Trak1 A T 9: 121,443,712 E119V probably null Het
Vmn1r1 T A 1: 182,157,951 I50L probably benign Het
Xpc C T 6: 91,504,578 V254I possibly damaging Het
Zfp58 G A 13: 67,492,082 Q97* probably null Het
Zscan5b A G 7: 6,233,912 E220G possibly damaging Het
Other mutations in Gbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Gbp10 APN 5 105221114 splice site probably benign
IGL01680:Gbp10 APN 5 105224271 splice site probably null
IGL01809:Gbp10 APN 5 105217359 missense probably benign
IGL01845:Gbp10 APN 5 105219949 splice site probably null
IGL02011:Gbp10 APN 5 105221101 missense probably damaging 1.00
IGL02063:Gbp10 APN 5 105236040 missense possibly damaging 0.95
IGL02533:Gbp10 APN 5 105220035 missense probably damaging 1.00
IGL02612:Gbp10 APN 5 105218502 missense possibly damaging 0.88
R0349:Gbp10 UTSW 5 105221076 missense possibly damaging 0.60
R0462:Gbp10 UTSW 5 105218524 missense possibly damaging 0.67
R1223:Gbp10 UTSW 5 105219001 missense probably damaging 1.00
R1704:Gbp10 UTSW 5 105224351 missense probably damaging 1.00
R1792:Gbp10 UTSW 5 105224300 missense probably damaging 1.00
R3738:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R3739:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R4035:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R4421:Gbp10 UTSW 5 105224651 splice site probably null
R5207:Gbp10 UTSW 5 105224709 missense probably benign 0.05
R5338:Gbp10 UTSW 5 105224300 missense probably damaging 1.00
R6010:Gbp10 UTSW 5 105224339 missense probably damaging 1.00
R6045:Gbp10 UTSW 5 105218403 missense probably damaging 0.98
R6156:Gbp10 UTSW 5 105236149 start gained probably benign
R6285:Gbp10 UTSW 5 105218460 missense probably damaging 1.00
R6525:Gbp10 UTSW 5 105236084 missense probably benign 0.01
R6908:Gbp10 UTSW 5 105221032 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGGAATGCTCCATGAAGACAGCC -3'
(R):5'- AACCACTAAAGCTGATCCCTTCTGC -3'

Sequencing Primer
(F):5'- CATGGCTTCCTTCTCGCAG -3'
(R):5'- CTGAAGGAGGTTTtgtgtgtg -3'
Posted On2013-06-12