Incidental Mutation 'R0535:Nomo1'
ID49414
Institutional Source Beutler Lab
Gene Symbol Nomo1
Ensembl Gene ENSMUSG00000030835
Gene Namenodal modulator 1
SynonymsPM5, D7Ertd156e, Nomo
MMRRC Submission 038727-MU
Accession Numbers

NCBI RefSeq: NM_153057.4; MGI: 2385850

Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R0535 (G1)
Quality Score165
Status Validated
Chromosome7
Chromosomal Location46033698-46084212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46072517 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 961 (S961T)
Ref Sequence ENSEMBL: ENSMUSP00000033121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033121]
Predicted Effect probably damaging
Transcript: ENSMUST00000033121
AA Change: S961T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033121
Gene: ENSMUSG00000030835
AA Change: S961T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
internal_repeat_1 22 215 2.35e-7 PROSPERO
Pfam:CarboxypepD_reg 322 395 3.5e-12 PFAM
Pfam:DUF2012 331 401 5.7e-10 PFAM
low complexity region 709 732 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
Blast:FN3 913 1017 6e-22 BLAST
low complexity region 1156 1164 N/A INTRINSIC
low complexity region 1203 1214 N/A INTRINSIC
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (52/54)
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,748,181 F118S possibly damaging Het
Aatk A G 11: 120,010,193 S1069P probably benign Het
Acmsd A T 1: 127,765,943 I305L probably benign Het
Aco2 G A 15: 81,913,217 E625K possibly damaging Het
Acox1 G A 11: 116,174,438 T561I possibly damaging Het
Acox2 T A 14: 8,256,753 T37S probably damaging Het
Apc A T 18: 34,261,072 K17M probably damaging Het
BC027072 A G 17: 71,752,439 V81A probably benign Het
Cant1 T C 11: 118,411,143 D116G probably damaging Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Cyp51 T C 5: 4,099,202 Q225R probably benign Het
E2f8 T C 7: 48,871,810 probably benign Het
Fam163b T C 2: 27,112,766 Y73C probably benign Het
Fbxw9 T C 8: 85,064,600 C271R probably damaging Het
Gbp10 T C 5: 105,221,011 N321D possibly damaging Het
Gle1 T C 2: 29,957,805 F675L probably damaging Het
Gm6327 T C 16: 12,760,377 noncoding transcript Het
Gphn T A 12: 78,492,050 F157I possibly damaging Het
Gtpbp1 A T 15: 79,707,732 T94S probably damaging Het
Hdac2 T C 10: 36,993,899 F286L probably benign Het
Ighv3-6 A T 12: 114,288,470 probably benign Het
Itga2b A G 11: 102,457,533 V791A possibly damaging Het
Itgb4 A T 11: 115,991,009 I796F possibly damaging Het
Kel T C 6: 41,690,838 K390R probably null Het
Krt42 C T 11: 100,264,586 C368Y probably damaging Het
Lancl1 A G 1: 67,009,906 probably benign Het
Lipg A G 18: 74,954,220 Y177H probably damaging Het
Lnpep T C 17: 17,571,673 E402G possibly damaging Het
Ltbp2 A T 12: 84,784,858 I1727N probably damaging Het
Ltbp2 A G 12: 84,791,052 F1185L probably damaging Het
Mettl22 T C 16: 8,484,346 probably benign Het
Mug1 G A 6: 121,851,454 G275E probably benign Het
Nell2 T A 15: 95,431,607 T278S probably benign Het
Olfr992 A G 2: 85,400,095 L146P possibly damaging Het
Phf2 A G 13: 48,813,947 Y675H unknown Het
Phldb2 A G 16: 45,757,127 V1145A probably damaging Het
Phrf1 T C 7: 141,260,065 S1058P probably benign Het
Prss3 T C 6: 41,374,969 N120S probably benign Het
Reln G T 5: 22,051,276 probably benign Het
Soga1 T C 2: 157,033,289 E847G possibly damaging Het
Spag5 A G 11: 78,304,728 Y287C probably benign Het
Syde2 G A 3: 145,989,170 probably null Het
Synj1 C A 16: 90,948,087 V1190F possibly damaging Het
Taok1 A T 11: 77,553,704 I515N probably benign Het
Tmem259 A T 10: 79,978,595 V309E probably damaging Het
Tmem62 T A 2: 121,002,596 V494E possibly damaging Het
Trak1 A T 9: 121,443,712 E119V probably null Het
Vmn1r1 T A 1: 182,157,951 I50L probably benign Het
Xpc C T 6: 91,504,578 V254I possibly damaging Het
Zfp58 G A 13: 67,492,082 Q97* probably null Het
Zscan5b A G 7: 6,233,912 E220G possibly damaging Het
Other mutations in Nomo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Nomo1 APN 7 46045336 missense possibly damaging 0.66
IGL00811:Nomo1 APN 7 46083308 missense possibly damaging 0.95
IGL01710:Nomo1 APN 7 46038556 missense probably damaging 1.00
IGL01797:Nomo1 APN 7 46056662 missense probably damaging 0.96
IGL01973:Nomo1 APN 7 46083227 splice site probably benign
IGL02506:Nomo1 APN 7 46078056 missense possibly damaging 0.50
IGL02739:Nomo1 APN 7 46044307 splice site probably null
IGL02863:Nomo1 APN 7 46046916 missense probably damaging 0.98
P0005:Nomo1 UTSW 7 46037557 critical splice acceptor site probably null
PIT4243001:Nomo1 UTSW 7 46044281 missense probably damaging 1.00
R0106:Nomo1 UTSW 7 46037632 missense probably damaging 1.00
R0106:Nomo1 UTSW 7 46037632 missense probably damaging 1.00
R0124:Nomo1 UTSW 7 46083228 splice site probably benign
R0239:Nomo1 UTSW 7 46079594 critical splice donor site probably null
R0239:Nomo1 UTSW 7 46079594 critical splice donor site probably null
R0417:Nomo1 UTSW 7 46068698 missense possibly damaging 0.51
R0467:Nomo1 UTSW 7 46072487 splice site probably null
R0829:Nomo1 UTSW 7 46076172 splice site probably benign
R0940:Nomo1 UTSW 7 46033905 missense possibly damaging 0.56
R1480:Nomo1 UTSW 7 46060913 missense probably damaging 0.98
R1601:Nomo1 UTSW 7 46046955 missense probably damaging 0.96
R1743:Nomo1 UTSW 7 46070037 critical splice donor site probably null
R1765:Nomo1 UTSW 7 46066293 missense possibly damaging 0.59
R1861:Nomo1 UTSW 7 46078101 missense probably benign 0.06
R1998:Nomo1 UTSW 7 46033944 missense possibly damaging 0.69
R1999:Nomo1 UTSW 7 46056727 missense possibly damaging 0.95
R2145:Nomo1 UTSW 7 46066504 missense probably damaging 1.00
R2869:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2869:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2870:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2870:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2871:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2871:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R2873:Nomo1 UTSW 7 46046937 missense probably damaging 0.96
R4116:Nomo1 UTSW 7 46033896 missense probably benign 0.06
R4404:Nomo1 UTSW 7 46056668 missense probably benign 0.00
R4406:Nomo1 UTSW 7 46056668 missense probably benign 0.00
R4560:Nomo1 UTSW 7 46041480 missense probably damaging 0.99
R4633:Nomo1 UTSW 7 46050260 splice site probably benign
R4651:Nomo1 UTSW 7 46068442 missense probably damaging 0.99
R4653:Nomo1 UTSW 7 46061813 missense probably benign 0.01
R4752:Nomo1 UTSW 7 46057202 missense probably damaging 1.00
R4792:Nomo1 UTSW 7 46044219 splice site probably null
R4838:Nomo1 UTSW 7 46083715 missense unknown
R4876:Nomo1 UTSW 7 46066491 missense probably damaging 1.00
R4915:Nomo1 UTSW 7 46044232 missense probably benign 0.30
R4953:Nomo1 UTSW 7 46050731 intron probably benign
R5463:Nomo1 UTSW 7 46063002 missense possibly damaging 0.47
R5664:Nomo1 UTSW 7 46076157 missense probably benign
R5956:Nomo1 UTSW 7 46042613 missense possibly damaging 0.51
R6037:Nomo1 UTSW 7 46062999 missense possibly damaging 0.64
R6037:Nomo1 UTSW 7 46062999 missense possibly damaging 0.64
R6307:Nomo1 UTSW 7 46033836 unclassified probably benign
R6695:Nomo1 UTSW 7 46066461 missense probably benign 0.16
R6970:Nomo1 UTSW 7 46045967 missense probably damaging 0.97
R7334:Nomo1 UTSW 7 46083268 missense probably damaging 1.00
R7394:Nomo1 UTSW 7 46066479 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCACAGTTTCAGATCAGCAGCGG -3'
(R):5'- TGTCGGCCAAAATACGAGCACAG -3'

Sequencing Primer
(F):5'- AGCGGTGGAAGCATCCTTATG -3'
(R):5'- CTGTTGGCCCAGGCTATC -3'
Posted On2013-06-12