Incidental Mutation 'R0535:Lipg'
ID49447
Institutional Source Beutler Lab
Gene Symbol Lipg
Ensembl Gene ENSMUSG00000053846
Gene Namelipase, endothelial
Synonymsendothelial lipase, EL, mEDL, 3110013K01Rik
MMRRC Submission 038727-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R0535 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location74939322-74961263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74954220 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 177 (Y177H)
Ref Sequence ENSEMBL: ENSMUSP00000066536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066532]
Predicted Effect probably damaging
Transcript: ENSMUST00000066532
AA Change: Y177H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066536
Gene: ENSMUSG00000053846
AA Change: Y177H

DomainStartEndE-ValueType
Pfam:Lipase 20 344 3.1e-108 PFAM
LH2 347 483 5.66e-6 SMART
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has substantial phospholipase activity and may be involved in lipoprotein metabolism and vascular biology. This protein is designated a member of the TG lipase family by its sequence and characteristic lid region which provides substrate specificity for enzymes of the TG lipase family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating total cholesterol and HDL as well as decreased monocyte binding to vascular endothelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,748,181 F118S possibly damaging Het
Aatk A G 11: 120,010,193 S1069P probably benign Het
Acmsd A T 1: 127,765,943 I305L probably benign Het
Aco2 G A 15: 81,913,217 E625K possibly damaging Het
Acox1 G A 11: 116,174,438 T561I possibly damaging Het
Acox2 T A 14: 8,256,753 T37S probably damaging Het
Apc A T 18: 34,261,072 K17M probably damaging Het
BC027072 A G 17: 71,752,439 V81A probably benign Het
Cant1 T C 11: 118,411,143 D116G probably damaging Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Cyp51 T C 5: 4,099,202 Q225R probably benign Het
E2f8 T C 7: 48,871,810 probably benign Het
Fam163b T C 2: 27,112,766 Y73C probably benign Het
Fbxw9 T C 8: 85,064,600 C271R probably damaging Het
Gbp10 T C 5: 105,221,011 N321D possibly damaging Het
Gle1 T C 2: 29,957,805 F675L probably damaging Het
Gm6327 T C 16: 12,760,377 noncoding transcript Het
Gphn T A 12: 78,492,050 F157I possibly damaging Het
Gtpbp1 A T 15: 79,707,732 T94S probably damaging Het
Hdac2 T C 10: 36,993,899 F286L probably benign Het
Ighv3-6 A T 12: 114,288,470 probably benign Het
Itga2b A G 11: 102,457,533 V791A possibly damaging Het
Itgb4 A T 11: 115,991,009 I796F possibly damaging Het
Kel T C 6: 41,690,838 K390R probably null Het
Krt42 C T 11: 100,264,586 C368Y probably damaging Het
Lancl1 A G 1: 67,009,906 probably benign Het
Lnpep T C 17: 17,571,673 E402G possibly damaging Het
Ltbp2 A T 12: 84,784,858 I1727N probably damaging Het
Ltbp2 A G 12: 84,791,052 F1185L probably damaging Het
Mettl22 T C 16: 8,484,346 probably benign Het
Mug1 G A 6: 121,851,454 G275E probably benign Het
Nell2 T A 15: 95,431,607 T278S probably benign Het
Nomo1 T A 7: 46,072,517 S961T probably damaging Het
Olfr992 A G 2: 85,400,095 L146P possibly damaging Het
Phf2 A G 13: 48,813,947 Y675H unknown Het
Phldb2 A G 16: 45,757,127 V1145A probably damaging Het
Phrf1 T C 7: 141,260,065 S1058P probably benign Het
Prss3 T C 6: 41,374,969 N120S probably benign Het
Reln G T 5: 22,051,276 probably benign Het
Soga1 T C 2: 157,033,289 E847G possibly damaging Het
Spag5 A G 11: 78,304,728 Y287C probably benign Het
Syde2 G A 3: 145,989,170 probably null Het
Synj1 C A 16: 90,948,087 V1190F possibly damaging Het
Taok1 A T 11: 77,553,704 I515N probably benign Het
Tmem259 A T 10: 79,978,595 V309E probably damaging Het
Tmem62 T A 2: 121,002,596 V494E possibly damaging Het
Trak1 A T 9: 121,443,712 E119V probably null Het
Vmn1r1 T A 1: 182,157,951 I50L probably benign Het
Xpc C T 6: 91,504,578 V254I possibly damaging Het
Zfp58 G A 13: 67,492,082 Q97* probably null Het
Zscan5b A G 7: 6,233,912 E220G possibly damaging Het
Other mutations in Lipg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Lipg APN 18 74947971 critical splice donor site probably null
IGL02340:Lipg APN 18 74960875 splice site probably null
IGL02804:Lipg APN 18 74949088 missense probably damaging 0.98
listube UTSW 18 74957236 missense probably benign 0.00
R0094:Lipg UTSW 18 74945846 missense probably benign 0.14
R0172:Lipg UTSW 18 74948174 missense possibly damaging 0.94
R0316:Lipg UTSW 18 74960941 missense probably benign 0.01
R0567:Lipg UTSW 18 74957369 missense probably benign 0.01
R1171:Lipg UTSW 18 74945823 missense possibly damaging 0.71
R1554:Lipg UTSW 18 74948047 missense probably damaging 1.00
R1611:Lipg UTSW 18 74948059 missense possibly damaging 0.81
R1916:Lipg UTSW 18 74960937 missense probably benign 0.00
R2125:Lipg UTSW 18 74945885 missense probably benign
R4196:Lipg UTSW 18 74945831 missense probably damaging 1.00
R4629:Lipg UTSW 18 74948036 nonsense probably null
R5186:Lipg UTSW 18 74960938 missense probably benign 0.00
R5424:Lipg UTSW 18 74954253 missense probably damaging 1.00
R5708:Lipg UTSW 18 74955434 missense possibly damaging 0.49
R6416:Lipg UTSW 18 74957236 missense probably benign 0.00
R6493:Lipg UTSW 18 74948024 missense probably damaging 0.99
R6601:Lipg UTSW 18 74948204 missense probably benign
R7199:Lipg UTSW 18 74955584 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATATGGAAGGGCACAGCTAACAC -3'
(R):5'- CAGCAAAACTGGCAATGCTACAGG -3'

Sequencing Primer
(F):5'- acacacacatacatatacacacatac -3'
(R):5'- GGAGTTGTATGCCTATGACCCC -3'
Posted On2013-06-12