Incidental Mutation 'R0536:Klhl41'
ID49450
Institutional Source Beutler Lab
Gene Symbol Klhl41
Ensembl Gene ENSMUSG00000075307
Gene Namekelch-like 41
SynonymsLOC228003, Kbtbd10
MMRRC Submission 038728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R0536 (G1)
Quality Score204
Status Validated
Chromosome2
Chromosomal Location69670120-69684230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69670210 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 5 (R5Q)
Ref Sequence ENSEMBL: ENSMUSP00000097627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074963] [ENSMUST00000100050] [ENSMUST00000112286] [ENSMUST00000134659]
Predicted Effect probably benign
Transcript: ENSMUST00000074963
SMART Domains Protein: ENSMUSP00000074494
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 7 339 6.2e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100050
AA Change: R5Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097627
Gene: ENSMUSG00000075307
AA Change: R5Q

DomainStartEndE-ValueType
BTB 33 130 8.34e-27 SMART
BACK 135 237 9.67e-36 SMART
Kelch 346 398 6.71e-1 SMART
Kelch 399 447 1.56e-5 SMART
Kelch 448 495 2.43e-7 SMART
Kelch 496 542 5.81e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112286
SMART Domains Protein: ENSMUSP00000107905
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 6 208 1.6e-100 PFAM
Pfam:DUF1448 206 319 9.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127806
SMART Domains Protein: ENSMUSP00000121691
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 22 90 9.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134659
SMART Domains Protein: ENSMUSP00000119377
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 6 88 3.1e-36 PFAM
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the kelch-like family. The encoded protein contains a BACK domain, a BTB/POZ domain, and 5 Kelch repeats. This protein is thought to function in skeletal muscle development and maintenance. Mutations in this gene have been associated with nemaline myopathy (NM), a rare congenital muscle disorder. [provided by RefSeq, Mar 2015]
PHENOTYPE: The gene product is involved in stabilizing proteins involved in muscle function. Homozygous knockout affects the structure of muscle fibers and their sarcomeres, resulting in neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,280,516 probably benign Het
Agrn A T 4: 156,179,553 D84E probably benign Het
Akap11 A G 14: 78,514,024 S308P probably damaging Het
Atp6v1c2 A T 12: 17,307,508 probably null Het
AW209491 A G 13: 14,636,973 Y137C probably damaging Het
Chst9 G A 18: 15,495,330 probably benign Het
Dok7 A G 5: 35,066,482 T122A probably damaging Het
Hoxb5 T C 11: 96,304,028 S139P possibly damaging Het
Ikzf4 T A 10: 128,641,249 E64D probably benign Het
Kif21a C A 15: 90,959,683 probably benign Het
Lama3 C T 18: 12,525,894 R2036C probably damaging Het
Lrba T A 3: 86,715,532 V311D probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mylk T C 16: 35,000,387 V1903A possibly damaging Het
Naa30 C T 14: 49,173,077 A154V possibly damaging Het
Olfr617 T C 7: 103,584,261 S80P probably damaging Het
Olfr705 T A 7: 106,714,321 Y120F probably damaging Het
Olfr938 G T 9: 39,078,329 Q139K probably benign Het
Pgm3 C T 9: 86,567,536 V144M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rgsl1 T A 1: 153,826,181 S211C probably damaging Het
Setx T C 2: 29,158,248 Y1954H possibly damaging Het
Sorcs3 C T 19: 48,802,698 Q1162* probably null Het
Sptbn2 T A 19: 4,726,690 D255E probably damaging Het
Ttc39b T C 4: 83,227,198 E597G probably damaging Het
Vldlr G A 19: 27,239,964 A436T probably damaging Het
Wdr72 G A 9: 74,157,408 G574D probably damaging Het
Zzz3 T G 3: 152,448,828 I572S probably damaging Het
Other mutations in Klhl41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Klhl41 APN 2 69674724 missense probably benign 0.00
IGL01622:Klhl41 APN 2 69678238 missense probably benign 0.05
IGL01623:Klhl41 APN 2 69678238 missense probably benign 0.05
IGL03237:Klhl41 APN 2 69670558 missense possibly damaging 0.94
R0220:Klhl41 UTSW 2 69670485 missense probably benign 0.25
R0277:Klhl41 UTSW 2 69671296 missense probably damaging 1.00
R0456:Klhl41 UTSW 2 69670549 missense probably damaging 0.99
R0485:Klhl41 UTSW 2 69671256 missense probably damaging 0.97
R0537:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0552:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0553:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0834:Klhl41 UTSW 2 69678147 missense possibly damaging 0.76
R0879:Klhl41 UTSW 2 69683483 unclassified probably benign
R1531:Klhl41 UTSW 2 69670740 missense probably benign 0.03
R1678:Klhl41 UTSW 2 69670939 missense probably benign 0.01
R1792:Klhl41 UTSW 2 69670802 missense probably benign 0.01
R1900:Klhl41 UTSW 2 69674619 splice site probably benign
R2012:Klhl41 UTSW 2 69683496 missense possibly damaging 0.61
R4041:Klhl41 UTSW 2 69670710 missense probably benign 0.00
R5223:Klhl41 UTSW 2 69679827 nonsense probably null
R5500:Klhl41 UTSW 2 69683529 missense probably damaging 1.00
R5643:Klhl41 UTSW 2 69670471 missense probably damaging 1.00
R5644:Klhl41 UTSW 2 69670471 missense probably damaging 1.00
R5656:Klhl41 UTSW 2 69683532 missense possibly damaging 0.89
R6264:Klhl41 UTSW 2 69679832 critical splice donor site probably null
R6678:Klhl41 UTSW 2 69670844 missense probably benign 0.04
R6731:Klhl41 UTSW 2 69674700 missense probably damaging 1.00
X0021:Klhl41 UTSW 2 69679706 missense probably damaging 1.00
Z1088:Klhl41 UTSW 2 69674730 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGCTGAACAGCAGCACTCCTTTCC -3'
(R):5'- ATCCACGTTGTCTAGGGCTACCTC -3'

Sequencing Primer
(F):5'- CCTAAATTCCCGTTGTTAGAGC -3'
(R):5'- GTCTAGGGCTACCTCCTTTTTTTTC -3'
Posted On2013-06-12