Incidental Mutation 'R0538:Dmbt1'
ID49585
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Namedeleted in malignant brain tumors 1
SynonymsCRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission 038730-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R0538 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location131032053-131121630 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 131049901 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
Predicted Effect probably benign
Transcript: ENSMUST00000084509
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208311
Predicted Effect probably benign
Transcript: ENSMUST00000213064
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (126/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik A T 14: 66,938,374 H6L unknown Het
Abca13 G A 11: 9,267,622 probably null Het
Acad12 C T 5: 121,607,448 R260Q possibly damaging Het
Actn1 G A 12: 80,260,100 probably benign Het
Acvrl1 A G 15: 101,136,149 T182A probably damaging Het
Adam23 T C 1: 63,567,844 probably benign Het
Adamtsl1 A T 4: 86,343,121 T1190S probably benign Het
Adh6b A T 3: 138,357,650 Y330F probably benign Het
Ak7 A G 12: 105,766,617 E540G probably damaging Het
Akr1c19 T A 13: 4,237,100 L106Q probably damaging Het
Ankrd12 A T 17: 66,049,852 S57T probably damaging Het
Aoc3 G A 11: 101,332,138 R400Q possibly damaging Het
Arel1 A T 12: 84,941,837 I46N probably damaging Het
Armc5 A G 7: 128,244,291 D752G probably damaging Het
Atp11b T C 3: 35,837,014 V812A probably damaging Het
Axin1 A G 17: 26,184,241 H131R possibly damaging Het
Bpifb3 A G 2: 153,923,869 E184G probably benign Het
Cacna2d2 T C 9: 107,524,383 probably benign Het
Catsperd T C 17: 56,662,828 F641L probably benign Het
Ccdc83 A C 7: 90,228,383 L284V probably damaging Het
Ccnt2 T A 1: 127,803,165 V593E probably damaging Het
Cd53 T A 3: 106,762,128 I185F probably benign Het
Cep350 A T 1: 155,848,620 D3077E possibly damaging Het
Ces1h C A 8: 93,357,000 probably null Het
Chrna3 T A 9: 55,016,006 T173S probably benign Het
Clca4b T C 3: 144,921,956 D418G probably benign Het
Col11a2 T C 17: 34,051,328 probably benign Het
Coq2 T A 5: 100,668,023 I97F possibly damaging Het
Cr2 A G 1: 195,160,359 probably benign Het
Ctgf T A 10: 24,596,466 C136S probably damaging Het
D2hgdh A G 1: 93,826,377 Y24C probably damaging Het
D630045J12Rik G A 6: 38,191,693 R974C probably damaging Het
Dach1 A G 14: 97,903,279 V429A possibly damaging Het
Ddr1 G A 17: 35,685,007 T660I probably damaging Het
Dlg1 A C 16: 31,796,864 probably null Het
Dmxl2 A T 9: 54,393,836 D2330E probably benign Het
Doc2a A G 7: 126,848,811 T5A probably benign Het
Dock2 G A 11: 34,704,718 probably benign Het
Dok4 T A 8: 94,865,238 Y290F probably damaging Het
Dopey1 A G 9: 86,485,497 D11G probably damaging Het
E230025N22Rik T C 18: 36,688,934 H235R probably benign Het
Ear6 A G 14: 51,854,452 D152G probably damaging Het
Ecscr T A 18: 35,713,636 probably benign Het
Eml6 A T 11: 29,760,010 probably benign Het
Epha4 T A 1: 77,388,541 Q607L probably damaging Het
Exoc4 A G 6: 33,972,063 N947S probably benign Het
Flg A G 3: 93,279,460 E73G probably damaging Het
Fndc1 C T 17: 7,784,341 probably benign Het
Gad1-ps T C 10: 99,444,992 noncoding transcript Het
Gata6 A G 18: 11,064,771 T528A probably benign Het
Gjd4 T C 18: 9,280,244 E278G probably benign Het
Gm13101 T A 4: 143,965,083 T357S possibly damaging Het
Gm20091 T A 10: 96,409,002 noncoding transcript Het
Gnb3 G A 6: 124,835,696 Q266* probably null Het
Grm3 A G 5: 9,512,446 V468A possibly damaging Het
Igf1r C T 7: 68,207,826 R1085C probably damaging Het
Igsf10 T C 3: 59,320,106 T2049A probably damaging Het
Jak3 A T 8: 71,685,482 D859V probably benign Het
Kcnb2 G T 1: 15,712,884 probably benign Het
Kcnh3 G A 15: 99,240,958 G858D probably benign Het
Kif1a C A 1: 93,043,638 R1006L probably damaging Het
Klhl23 C T 2: 69,824,413 A209V probably benign Het
Mapk13 T C 17: 28,775,255 Y104H probably damaging Het
Mbd4 A G 6: 115,849,482 S183P probably damaging Het
Mga T C 2: 119,919,706 probably null Het
Mipol1 G A 12: 57,414,411 probably null Het
Mmp14 A G 14: 54,438,709 T299A possibly damaging Het
Mmrn1 A G 6: 60,976,469 E578G probably benign Het
Mov10l1 G A 15: 88,994,860 C193Y possibly damaging Het
Mppe1 A G 18: 67,237,477 C50R probably damaging Het
Msantd1 C A 5: 34,917,725 R44S probably damaging Het
Myt1l T C 12: 29,842,571 V69A possibly damaging Het
Nav1 A T 1: 135,464,692 probably benign Het
Ncan A G 8: 70,108,602 S572P possibly damaging Het
Nck2 T C 1: 43,569,144 probably benign Het
Nemf A T 12: 69,356,314 D31E probably damaging Het
Nlrp12 T C 7: 3,249,262 D93G possibly damaging Het
Nsmaf A T 4: 6,419,930 probably null Het
Nup98 T C 7: 102,186,685 T184A probably damaging Het
Olfr1415 A T 1: 92,491,333 C141S possibly damaging Het
Olfr46 A T 7: 140,610,384 N73Y probably damaging Het
Olfr522 A T 7: 140,162,231 S240T probably damaging Het
Oog2 C A 4: 144,196,084 Y306* probably null Het
Osmr A G 15: 6,841,938 probably benign Het
P2rx6 A G 16: 17,568,298 N275S probably benign Het
Papd4 A T 13: 93,175,615 probably benign Het
Pbxip1 G T 3: 89,447,619 G482W possibly damaging Het
Pcsk4 T G 10: 80,325,334 I249L probably damaging Het
Pou4f2 C T 8: 78,435,662 G104E probably damaging Het
Prkdc G T 16: 15,833,788 R3763L probably damaging Het
Ptpre A T 7: 135,663,315 I207F probably damaging Het
Rapgef3 A T 15: 97,757,817 probably benign Het
Rasgrp1 T G 2: 117,284,947 K685T probably benign Het
Rnf148 C T 6: 23,654,238 R253Q probably damaging Het
Rock1 T C 18: 10,132,227 I241V possibly damaging Het
Rp1l1 T G 14: 64,022,092 V61G probably damaging Het
Scin A C 12: 40,081,771 S255A probably damaging Het
Scn8a A T 15: 101,035,624 K1570* probably null Het
Sec14l4 A C 11: 4,040,018 M106L probably benign Het
Sec63 G A 10: 42,798,799 R226H probably benign Het
Sept2 T A 1: 93,501,623 N271K probably damaging Het
Serac1 G T 17: 6,048,826 probably benign Het
Shc2 T A 10: 79,630,140 probably benign Het
Sipa1l1 T A 12: 82,425,099 D1284E probably benign Het
Slc11a2 A G 15: 100,408,216 L105P probably damaging Het
Slc1a3 T A 15: 8,650,922 T151S probably benign Het
Smarca2 G T 19: 26,691,362 K920N probably damaging Het
Sugp2 G A 8: 70,258,948 E964K probably damaging Het
Tas2r122 A C 6: 132,711,815 N38K probably benign Het
Tecpr1 G A 5: 144,206,274 R730C probably damaging Het
Themis3 G T 17: 66,593,270 N34K possibly damaging Het
Traf3ip1 A G 1: 91,499,619 T104A unknown Het
Trappc11 A G 8: 47,503,412 V843A probably benign Het
Trmt61a T A 12: 111,678,927 L99Q probably damaging Het
Trp53tg5 T A 2: 164,471,481 K91N probably damaging Het
Ufsp2 T C 8: 45,992,150 S339P probably damaging Het
Usp20 T A 2: 31,004,450 V126E probably damaging Het
Vmn1r75 T A 7: 11,880,870 N176K probably damaging Het
Vmn2r24 A G 6: 123,816,053 S780G probably benign Het
Vmn2r89 A G 14: 51,457,591 probably null Het
Vps13d A T 4: 145,045,095 S4038T probably damaging Het
Vwa7 A G 17: 35,022,651 T421A probably damaging Het
Wdr78 T C 4: 103,096,618 N128S possibly damaging Het
Wdr95 C A 5: 149,580,806 L332I probably damaging Het
Wrn T A 8: 33,336,091 K181I probably damaging Het
Zc3h6 T A 2: 129,017,223 I1058N possibly damaging Het
Zfp423 T A 8: 87,782,085 I544F probably damaging Het
Zfp446 T A 7: 12,979,589 S161T possibly damaging Het
Zmym6 T A 4: 127,123,369 M889K probably benign Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131079540 intron probably benign
IGL00161:Dmbt1 APN 7 131109628 missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131099290 missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131082500 missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131097607 missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131058158 missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131085368 splice site probably benign
IGL01317:Dmbt1 APN 7 131041191 missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131088767 missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131103679 missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131116728 missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131081185 missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131074419 intron probably benign
IGL02160:Dmbt1 APN 7 131082688 missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131093256 splice site probably benign
IGL02197:Dmbt1 APN 7 131085422 splice site probably benign
IGL02332:Dmbt1 APN 7 131066613 intron probably benign
IGL02427:Dmbt1 APN 7 131088085 splice site probably null
IGL02726:Dmbt1 APN 7 131074410 intron probably benign
IGL02967:Dmbt1 APN 7 131071189 missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131082679 missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131111049 missense probably damaging 0.99
H8562:Dmbt1 UTSW 7 131112076 nonsense probably null
K3955:Dmbt1 UTSW 7 131119564 missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131106393 missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131096049 splice site probably benign
R0427:Dmbt1 UTSW 7 131040902 nonsense probably null
R0478:Dmbt1 UTSW 7 131041187 missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131097673 splice site probably null
R0626:Dmbt1 UTSW 7 131102081 missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131097653 missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131093117 missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131074524 critical splice donor site probably null
R1413:Dmbt1 UTSW 7 131050214 missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 131044487 splice site probably benign
R1463:Dmbt1 UTSW 7 131109637 critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131074331 intron probably benign
R1990:Dmbt1 UTSW 7 131058288 missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131106359 missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 131099133 missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 131050018 missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 131102032 missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131097575 missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131046562 missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131090494 missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131106468 missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131094734 nonsense probably null
R3014:Dmbt1 UTSW 7 131032097 intron probably benign
R3155:Dmbt1 UTSW 7 131050157 nonsense probably null
R3176:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131106249 missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131112090 missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131074202 intron probably benign
R4396:Dmbt1 UTSW 7 131116632 missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131040934 missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 131050012 missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131094742 missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131097670 critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131094735 missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131082619 missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 131041021 missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131119511 missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131040993 missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131063403 intron probably benign
R5526:Dmbt1 UTSW 7 131041190 missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131099300 nonsense probably null
R5566:Dmbt1 UTSW 7 131106273 missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131054067 missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131109641 splice site probably null
R6188:Dmbt1 UTSW 7 131097631 missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131058254 missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131103578 missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131116641 missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131046510 intron probably null
R6719:Dmbt1 UTSW 7 131119603 missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131046561 missense probably benign 0.16
R7148:Dmbt1 UTSW 7 131066734 nonsense probably null
R7191:Dmbt1 UTSW 7 131044520 missense unknown
R7269:Dmbt1 UTSW 7 131066621 missense unknown
R7288:Dmbt1 UTSW 7 131083789 nonsense probably null
R7296:Dmbt1 UTSW 7 131112132 missense unknown
R7349:Dmbt1 UTSW 7 131041124 missense unknown
R7386:Dmbt1 UTSW 7 131112236 missense unknown
X0024:Dmbt1 UTSW 7 131112248 nonsense probably null
X0062:Dmbt1 UTSW 7 131094851 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGGGGTACAGGTCTTTACAAGACAGTG -3'
(R):5'- TCCACAGATAGTTCTCATAGCCTCCAC -3'

Sequencing Primer
(F):5'- CTTTACAAGACAGTGTGGTCAG -3'
(R):5'- TCCAAAGTAGGCATTTCCTGG -3'
Posted On2013-06-12