Incidental Mutation 'R0538:Abca13'
ID49610
Institutional Source Beutler Lab
Gene Symbol Abca13
Ensembl Gene ENSMUSG00000004668
Gene NameATP-binding cassette, sub-family A (ABC1), member 13
SynonymsA930002G16Rik
MMRRC Submission 038730-MU
Accession Numbers

NCBI RefSeq: NM_178259.3; MGI:2388707

Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0538 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location9191942-9684259 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 9267622 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042740]
Predicted Effect probably null
Transcript: ENSMUST00000042740
SMART Domains Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 1382 1393 N/A INTRINSIC
low complexity region 1721 1737 N/A INTRINSIC
low complexity region 1859 1872 N/A INTRINSIC
Pfam:ABC2_membrane_3 3288 3740 4.7e-21 PFAM
low complexity region 3796 3809 N/A INTRINSIC
AAA 3835 4019 8.08e-12 SMART
transmembrane domain 4206 4228 N/A INTRINSIC
Pfam:ABC2_membrane_3 4317 4646 1.6e-33 PFAM
AAA 4721 4909 8.86e-9 SMART
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (126/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(3) : Targeted(3

Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik A T 14: 66,938,374 H6L unknown Het
Acad12 C T 5: 121,607,448 R260Q possibly damaging Het
Actn1 G A 12: 80,260,100 probably benign Het
Acvrl1 A G 15: 101,136,149 T182A probably damaging Het
Adam23 T C 1: 63,567,844 probably benign Het
Adamtsl1 A T 4: 86,343,121 T1190S probably benign Het
Adh6b A T 3: 138,357,650 Y330F probably benign Het
Ak7 A G 12: 105,766,617 E540G probably damaging Het
Akr1c19 T A 13: 4,237,100 L106Q probably damaging Het
Ankrd12 A T 17: 66,049,852 S57T probably damaging Het
Aoc3 G A 11: 101,332,138 R400Q possibly damaging Het
Arel1 A T 12: 84,941,837 I46N probably damaging Het
Armc5 A G 7: 128,244,291 D752G probably damaging Het
Atp11b T C 3: 35,837,014 V812A probably damaging Het
Axin1 A G 17: 26,184,241 H131R possibly damaging Het
Bpifb3 A G 2: 153,923,869 E184G probably benign Het
Cacna2d2 T C 9: 107,524,383 probably benign Het
Catsperd T C 17: 56,662,828 F641L probably benign Het
Ccdc83 A C 7: 90,228,383 L284V probably damaging Het
Ccnt2 T A 1: 127,803,165 V593E probably damaging Het
Cd53 T A 3: 106,762,128 I185F probably benign Het
Cep350 A T 1: 155,848,620 D3077E possibly damaging Het
Ces1h C A 8: 93,357,000 probably null Het
Chrna3 T A 9: 55,016,006 T173S probably benign Het
Clca4b T C 3: 144,921,956 D418G probably benign Het
Col11a2 T C 17: 34,051,328 probably benign Het
Coq2 T A 5: 100,668,023 I97F possibly damaging Het
Cr2 A G 1: 195,160,359 probably benign Het
Ctgf T A 10: 24,596,466 C136S probably damaging Het
D2hgdh A G 1: 93,826,377 Y24C probably damaging Het
D630045J12Rik G A 6: 38,191,693 R974C probably damaging Het
Dach1 A G 14: 97,903,279 V429A possibly damaging Het
Ddr1 G A 17: 35,685,007 T660I probably damaging Het
Dlg1 A C 16: 31,796,864 probably null Het
Dmbt1 T C 7: 131,049,901 probably benign Het
Dmxl2 A T 9: 54,393,836 D2330E probably benign Het
Doc2a A G 7: 126,848,811 T5A probably benign Het
Dock2 G A 11: 34,704,718 probably benign Het
Dok4 T A 8: 94,865,238 Y290F probably damaging Het
Dopey1 A G 9: 86,485,497 D11G probably damaging Het
E230025N22Rik T C 18: 36,688,934 H235R probably benign Het
Ear6 A G 14: 51,854,452 D152G probably damaging Het
Ecscr T A 18: 35,713,636 probably benign Het
Eml6 A T 11: 29,760,010 probably benign Het
Epha4 T A 1: 77,388,541 Q607L probably damaging Het
Exoc4 A G 6: 33,972,063 N947S probably benign Het
Flg A G 3: 93,279,460 E73G probably damaging Het
Fndc1 C T 17: 7,784,341 probably benign Het
Gad1-ps T C 10: 99,444,992 noncoding transcript Het
Gata6 A G 18: 11,064,771 T528A probably benign Het
Gjd4 T C 18: 9,280,244 E278G probably benign Het
Gm13101 T A 4: 143,965,083 T357S possibly damaging Het
Gm20091 T A 10: 96,409,002 noncoding transcript Het
Gnb3 G A 6: 124,835,696 Q266* probably null Het
Grm3 A G 5: 9,512,446 V468A possibly damaging Het
Igf1r C T 7: 68,207,826 R1085C probably damaging Het
Igsf10 T C 3: 59,320,106 T2049A probably damaging Het
Jak3 A T 8: 71,685,482 D859V probably benign Het
Kcnb2 G T 1: 15,712,884 probably benign Het
Kcnh3 G A 15: 99,240,958 G858D probably benign Het
Kif1a C A 1: 93,043,638 R1006L probably damaging Het
Klhl23 C T 2: 69,824,413 A209V probably benign Het
Mapk13 T C 17: 28,775,255 Y104H probably damaging Het
Mbd4 A G 6: 115,849,482 S183P probably damaging Het
Mga T C 2: 119,919,706 probably null Het
Mipol1 G A 12: 57,414,411 probably null Het
Mmp14 A G 14: 54,438,709 T299A possibly damaging Het
Mmrn1 A G 6: 60,976,469 E578G probably benign Het
Mov10l1 G A 15: 88,994,860 C193Y possibly damaging Het
Mppe1 A G 18: 67,237,477 C50R probably damaging Het
Msantd1 C A 5: 34,917,725 R44S probably damaging Het
Myt1l T C 12: 29,842,571 V69A possibly damaging Het
Nav1 A T 1: 135,464,692 probably benign Het
Ncan A G 8: 70,108,602 S572P possibly damaging Het
Nck2 T C 1: 43,569,144 probably benign Het
Nemf A T 12: 69,356,314 D31E probably damaging Het
Nlrp12 T C 7: 3,249,262 D93G possibly damaging Het
Nsmaf A T 4: 6,419,930 probably null Het
Nup98 T C 7: 102,186,685 T184A probably damaging Het
Olfr1415 A T 1: 92,491,333 C141S possibly damaging Het
Olfr46 A T 7: 140,610,384 N73Y probably damaging Het
Olfr522 A T 7: 140,162,231 S240T probably damaging Het
Oog2 C A 4: 144,196,084 Y306* probably null Het
Osmr A G 15: 6,841,938 probably benign Het
P2rx6 A G 16: 17,568,298 N275S probably benign Het
Papd4 A T 13: 93,175,615 probably benign Het
Pbxip1 G T 3: 89,447,619 G482W possibly damaging Het
Pcsk4 T G 10: 80,325,334 I249L probably damaging Het
Pou4f2 C T 8: 78,435,662 G104E probably damaging Het
Prkdc G T 16: 15,833,788 R3763L probably damaging Het
Ptpre A T 7: 135,663,315 I207F probably damaging Het
Rapgef3 A T 15: 97,757,817 probably benign Het
Rasgrp1 T G 2: 117,284,947 K685T probably benign Het
Rnf148 C T 6: 23,654,238 R253Q probably damaging Het
Rock1 T C 18: 10,132,227 I241V possibly damaging Het
Rp1l1 T G 14: 64,022,092 V61G probably damaging Het
Scin A C 12: 40,081,771 S255A probably damaging Het
Scn8a A T 15: 101,035,624 K1570* probably null Het
Sec14l4 A C 11: 4,040,018 M106L probably benign Het
Sec63 G A 10: 42,798,799 R226H probably benign Het
Sept2 T A 1: 93,501,623 N271K probably damaging Het
Serac1 G T 17: 6,048,826 probably benign Het
Shc2 T A 10: 79,630,140 probably benign Het
Sipa1l1 T A 12: 82,425,099 D1284E probably benign Het
Slc11a2 A G 15: 100,408,216 L105P probably damaging Het
Slc1a3 T A 15: 8,650,922 T151S probably benign Het
Smarca2 G T 19: 26,691,362 K920N probably damaging Het
Sugp2 G A 8: 70,258,948 E964K probably damaging Het
Tas2r122 A C 6: 132,711,815 N38K probably benign Het
Tecpr1 G A 5: 144,206,274 R730C probably damaging Het
Themis3 G T 17: 66,593,270 N34K possibly damaging Het
Traf3ip1 A G 1: 91,499,619 T104A unknown Het
Trappc11 A G 8: 47,503,412 V843A probably benign Het
Trmt61a T A 12: 111,678,927 L99Q probably damaging Het
Trp53tg5 T A 2: 164,471,481 K91N probably damaging Het
Ufsp2 T C 8: 45,992,150 S339P probably damaging Het
Usp20 T A 2: 31,004,450 V126E probably damaging Het
Vmn1r75 T A 7: 11,880,870 N176K probably damaging Het
Vmn2r24 A G 6: 123,816,053 S780G probably benign Het
Vmn2r89 A G 14: 51,457,591 probably null Het
Vps13d A T 4: 145,045,095 S4038T probably damaging Het
Vwa7 A G 17: 35,022,651 T421A probably damaging Het
Wdr78 T C 4: 103,096,618 N128S possibly damaging Het
Wdr95 C A 5: 149,580,806 L332I probably damaging Het
Wrn T A 8: 33,336,091 K181I probably damaging Het
Zc3h6 T A 2: 129,017,223 I1058N possibly damaging Het
Zfp423 T A 8: 87,782,085 I544F probably damaging Het
Zfp446 T A 7: 12,979,589 S161T possibly damaging Het
Zmym6 T A 4: 127,123,369 M889K probably benign Het
Other mutations in Abca13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Abca13 APN 11 9297443 missense probably benign 0.24
IGL00481:Abca13 APN 11 9290969 missense probably damaging 0.99
IGL00707:Abca13 APN 11 9291586 missense probably damaging 0.99
IGL00755:Abca13 APN 11 9542102 missense possibly damaging 0.87
IGL00771:Abca13 APN 11 9290870 missense probably damaging 1.00
IGL00802:Abca13 APN 11 9297717 missense probably damaging 0.96
IGL00807:Abca13 APN 11 9378285 missense probably benign 0.10
IGL00977:Abca13 APN 11 9399284 missense probably damaging 1.00
IGL01064:Abca13 APN 11 9483855 missense probably benign 0.01
IGL01100:Abca13 APN 11 9274673 splice site probably null
IGL01290:Abca13 APN 11 9256232 missense probably damaging 1.00
IGL01299:Abca13 APN 11 9298743 missense probably benign 0.22
IGL01302:Abca13 APN 11 9399470 splice site probably benign
IGL01307:Abca13 APN 11 9297159 missense possibly damaging 0.86
IGL01349:Abca13 APN 11 9292076 missense probably benign 0.05
IGL01351:Abca13 APN 11 9267565 missense probably benign 0.28
IGL01446:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01453:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01461:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01476:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01506:Abca13 APN 11 9297447 missense probably benign 0.36
IGL01527:Abca13 APN 11 9290788 missense possibly damaging 0.49
IGL01559:Abca13 APN 11 9309020 missense possibly damaging 0.82
IGL01580:Abca13 APN 11 9293527 missense probably benign 0.00
IGL01679:Abca13 APN 11 9298071 missense probably benign 0.07
IGL01731:Abca13 APN 11 9249749 splice site probably benign
IGL01762:Abca13 APN 11 9315423 missense probably benign 0.18
IGL01781:Abca13 APN 11 9399280 missense probably damaging 1.00
IGL01802:Abca13 APN 11 9292438 missense probably benign 0.00
IGL01809:Abca13 APN 11 9290339 missense probably damaging 0.96
IGL01906:Abca13 APN 11 9216225 missense probably damaging 1.00
IGL01928:Abca13 APN 11 9683342 missense probably benign 0.13
IGL01940:Abca13 APN 11 9567661 splice site probably benign
IGL01993:Abca13 APN 11 9258452 unclassified probably benign
IGL02039:Abca13 APN 11 9297193 nonsense probably null
IGL02159:Abca13 APN 11 9314545 missense probably benign 0.00
IGL02202:Abca13 APN 11 9288529 missense possibly damaging 0.55
IGL02268:Abca13 APN 11 9290626 missense probably benign 0.00
IGL02332:Abca13 APN 11 9291482 missense probably damaging 0.98
IGL02380:Abca13 APN 11 9291599 missense possibly damaging 0.73
IGL02466:Abca13 APN 11 9297527 missense probably benign 0.00
IGL02505:Abca13 APN 11 9581498 missense probably damaging 1.00
IGL02507:Abca13 APN 11 9399388 missense probably damaging 1.00
IGL02558:Abca13 APN 11 9399387 missense probably damaging 1.00
IGL02581:Abca13 APN 11 9399132 splice site probably benign
IGL02586:Abca13 APN 11 9293983 missense possibly damaging 0.56
IGL02598:Abca13 APN 11 9431898 missense probably damaging 1.00
IGL02747:Abca13 APN 11 9373282 nonsense probably null
IGL02893:Abca13 APN 11 9290543 missense probably damaging 0.96
IGL02930:Abca13 APN 11 9378226 missense possibly damaging 0.86
IGL02967:Abca13 APN 11 9378291 missense probably damaging 0.99
IGL02983:Abca13 APN 11 9290663 missense probably benign 0.40
IGL02999:Abca13 APN 11 9581757 splice site probably benign
IGL03100:Abca13 APN 11 9258527 missense probably benign 0.25
IGL03114:Abca13 APN 11 9528999 missense probably benign 0.06
IGL03230:Abca13 APN 11 9294313 missense probably benign 0.02
IGL03329:Abca13 APN 11 9298047 missense probably benign 0.08
IGL03380:Abca13 APN 11 9298574 missense probably benign 0.10
IGL02835:Abca13 UTSW 11 9451515 missense probably damaging 1.00
R0017:Abca13 UTSW 11 9292775 missense probably damaging 0.99
R0079:Abca13 UTSW 11 9293493 missense probably benign 0.00
R0089:Abca13 UTSW 11 9292886 missense possibly damaging 0.76
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0113:Abca13 UTSW 11 9292114 missense possibly damaging 0.54
R0119:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0152:Abca13 UTSW 11 9581724 missense probably damaging 0.98
R0255:Abca13 UTSW 11 9581545 missense probably damaging 1.00
R0277:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0278:Abca13 UTSW 11 9378215 missense probably damaging 1.00
R0294:Abca13 UTSW 11 9269122 splice site probably null
R0299:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0310:Abca13 UTSW 11 9293810 missense probably benign 0.36
R0317:Abca13 UTSW 11 9293459 missense probably damaging 1.00
R0323:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0324:Abca13 UTSW 11 9297669 missense possibly damaging 0.76
R0329:Abca13 UTSW 11 9399430 missense probably damaging 0.97
R0336:Abca13 UTSW 11 9298481 missense probably benign 0.04
R0346:Abca13 UTSW 11 9566278 missense probably damaging 0.99
R0380:Abca13 UTSW 11 9588500 splice site probably null
R0382:Abca13 UTSW 11 9636650 splice site probably benign
R0482:Abca13 UTSW 11 9328207 missense possibly damaging 0.88
R0487:Abca13 UTSW 11 9331687 missense probably benign 0.07
R0491:Abca13 UTSW 11 9298235 missense probably benign 0.02
R0496:Abca13 UTSW 11 9291701 missense probably benign 0.01
R0505:Abca13 UTSW 11 9291058 missense probably benign 0.00
R0511:Abca13 UTSW 11 9294559 missense probably benign
R0525:Abca13 UTSW 11 9293371 missense probably damaging 1.00
R0615:Abca13 UTSW 11 9256197 missense probably damaging 0.96
R0634:Abca13 UTSW 11 9314491 missense possibly damaging 0.59
R0699:Abca13 UTSW 11 9588508 splice site probably benign
R0848:Abca13 UTSW 11 9682011 nonsense probably null
R0883:Abca13 UTSW 11 9291238 nonsense probably null
R0892:Abca13 UTSW 11 9298305 missense probably benign 0.00
R0904:Abca13 UTSW 11 9298740 missense probably benign 0.22
R0968:Abca13 UTSW 11 9298016 missense probably benign 0.00
R1187:Abca13 UTSW 11 9528981 missense probably benign 0.00
R1299:Abca13 UTSW 11 9294821 missense possibly damaging 0.94
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1368:Abca13 UTSW 11 9291836 missense probably benign
R1387:Abca13 UTSW 11 9682085 nonsense probably null
R1436:Abca13 UTSW 11 9292646 missense probably damaging 0.99
R1449:Abca13 UTSW 11 9298580 missense probably damaging 1.00
R1450:Abca13 UTSW 11 9430531 splice site probably benign
R1462:Abca13 UTSW 11 9483924 splice site probably benign
R1465:Abca13 UTSW 11 9399303 missense probably damaging 1.00
R1465:Abca13 UTSW 11 9399303 missense probably damaging 1.00
R1466:Abca13 UTSW 11 9570536 splice site probably benign
R1494:Abca13 UTSW 11 9466429 nonsense probably null
R1559:Abca13 UTSW 11 9399180 missense probably null 1.00
R1564:Abca13 UTSW 11 9434316 nonsense probably null
R1698:Abca13 UTSW 11 9314507 missense probably benign 0.13
R1728:Abca13 UTSW 11 9249680 missense probably benign 0.02
R1734:Abca13 UTSW 11 9585460 missense probably benign 0.03
R1781:Abca13 UTSW 11 9269194 missense probably damaging 1.00
R1782:Abca13 UTSW 11 9297971 missense probably benign 0.36
R1807:Abca13 UTSW 11 9291755 missense probably damaging 0.98
R1830:Abca13 UTSW 11 9290350 missense probably benign 0.04
R1869:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1870:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1871:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1903:Abca13 UTSW 11 9466411 missense probably benign 0.13
R1916:Abca13 UTSW 11 9534456 missense probably damaging 1.00
R1936:Abca13 UTSW 11 9293595 missense probably benign 0.13
R1976:Abca13 UTSW 11 9397815 missense probably damaging 1.00
R2001:Abca13 UTSW 11 9273967 missense probably benign 0.01
R2007:Abca13 UTSW 11 9191987 missense probably benign 0.19
R2016:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2017:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2034:Abca13 UTSW 11 9292628 missense possibly damaging 0.83
R2051:Abca13 UTSW 11 9328098 missense probably benign 0.04
R2075:Abca13 UTSW 11 9522382 missense probably damaging 1.00
R2118:Abca13 UTSW 11 9309013 splice site probably benign
R2120:Abca13 UTSW 11 9309013 splice site probably benign
R2124:Abca13 UTSW 11 9309013 splice site probably benign
R2148:Abca13 UTSW 11 9615764 missense probably damaging 1.00
R2149:Abca13 UTSW 11 9267508 missense possibly damaging 0.68
R2157:Abca13 UTSW 11 9577170 missense probably damaging 0.97
R2167:Abca13 UTSW 11 9288532 missense probably benign 0.19
R2261:Abca13 UTSW 11 9292288 missense probably benign
R2263:Abca13 UTSW 11 9274702 missense probably benign 0.04
R2281:Abca13 UTSW 11 9328136 missense probably damaging 0.98
R2340:Abca13 UTSW 11 9399165 missense probably damaging 0.99
R2357:Abca13 UTSW 11 9297336 missense probably damaging 1.00
R2370:Abca13 UTSW 11 9256185 missense possibly damaging 0.85
R2384:Abca13 UTSW 11 9267450 splice site probably benign
R2393:Abca13 UTSW 11 9275057 nonsense probably null
R2432:Abca13 UTSW 11 9451333 splice site probably benign
R2446:Abca13 UTSW 11 9275101 missense probably benign
R2568:Abca13 UTSW 11 9333310 missense probably benign 0.40
R2847:Abca13 UTSW 11 9294584 missense possibly damaging 0.59
R2860:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2861:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2862:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2877:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R2878:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R3748:Abca13 UTSW 11 9316119 splice site probably benign
R3789:Abca13 UTSW 11 9510668 missense probably damaging 0.97
R3933:Abca13 UTSW 11 9354856 missense probably damaging 1.00
R3981:Abca13 UTSW 11 9532407 missense probably benign
R4002:Abca13 UTSW 11 9585415 missense probably benign 0.00
R4010:Abca13 UTSW 11 9622013 splice site probably benign
R4011:Abca13 UTSW 11 9622013 splice site probably benign
R4127:Abca13 UTSW 11 9191973 missense probably benign 0.00
R4214:Abca13 UTSW 11 9293877 missense probably damaging 0.96
R4236:Abca13 UTSW 11 9256205 missense probably damaging 1.00
R4237:Abca13 UTSW 11 9434188 missense probably benign 0.01
R4359:Abca13 UTSW 11 9297629 missense probably benign 0.02
R4378:Abca13 UTSW 11 9293644 missense probably benign 0.00
R4389:Abca13 UTSW 11 9297878 missense probably damaging 0.98
R4392:Abca13 UTSW 11 9309034 missense possibly damaging 0.94
R4623:Abca13 UTSW 11 9309130 missense probably damaging 1.00
R4684:Abca13 UTSW 11 9434193 nonsense probably null
R4691:Abca13 UTSW 11 9434195 missense probably damaging 1.00
R4700:Abca13 UTSW 11 9292306 missense possibly damaging 0.59
R4701:Abca13 UTSW 11 9292306 missense possibly damaging 0.59
R4704:Abca13 UTSW 11 9276990 missense possibly damaging 0.94
R4751:Abca13 UTSW 11 9277973 critical splice donor site probably null
R4772:Abca13 UTSW 11 9315339 splice site probably null
R4782:Abca13 UTSW 11 9328096 missense probably damaging 0.96
R4801:Abca13 UTSW 11 9522341 missense possibly damaging 0.94
R4802:Abca13 UTSW 11 9522341 missense possibly damaging 0.94
R4819:Abca13 UTSW 11 9290421 missense possibly damaging 0.88
R4831:Abca13 UTSW 11 9542077 nonsense probably null
R4851:Abca13 UTSW 11 9483890 missense probably benign 0.02
R4857:Abca13 UTSW 11 9294143 missense probably benign 0.22
R4869:Abca13 UTSW 11 9315434 splice site probably null
R4982:Abca13 UTSW 11 9292348 missense possibly damaging 0.58
R5031:Abca13 UTSW 11 9297678 missense probably damaging 0.99
R5044:Abca13 UTSW 11 9373323 missense possibly damaging 0.80
R5092:Abca13 UTSW 11 9258535 missense probably damaging 1.00
R5155:Abca13 UTSW 11 9532447 missense probably damaging 0.98
R5173:Abca13 UTSW 11 9682032 frame shift probably null
R5180:Abca13 UTSW 11 9466510 missense probably benign 0.01
R5244:Abca13 UTSW 11 9275081 missense probably benign 0.28
R5257:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5258:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5299:Abca13 UTSW 11 9431861 missense probably damaging 1.00
R5363:Abca13 UTSW 11 9277035 missense possibly damaging 0.75
R5365:Abca13 UTSW 11 9628629 missense probably damaging 1.00
R5419:Abca13 UTSW 11 9193533 critical splice donor site probably null
R5426:Abca13 UTSW 11 9290722 missense probably damaging 1.00
R5468:Abca13 UTSW 11 9294062 missense probably damaging 1.00
R5477:Abca13 UTSW 11 9301298 missense possibly damaging 0.49
R5541:Abca13 UTSW 11 9291545 missense probably benign 0.00
R5553:Abca13 UTSW 11 9328158 missense probably damaging 1.00
R5556:Abca13 UTSW 11 9258546 missense possibly damaging 0.91
R5566:Abca13 UTSW 11 9294615 nonsense probably null
R5582:Abca13 UTSW 11 9636639 splice site probably null
R5604:Abca13 UTSW 11 9566279 missense probably damaging 0.97
R5609:Abca13 UTSW 11 9403874 missense probably benign 0.01
R5617:Abca13 UTSW 11 9277891 missense probably benign 0.00
R5693:Abca13 UTSW 11 9316233 missense probably benign 0.29
R5707:Abca13 UTSW 11 9510620 missense probably damaging 1.00
R5725:Abca13 UTSW 11 9577181 missense probably benign 0.00
R5728:Abca13 UTSW 11 9570576 missense probably damaging 1.00
R5738:Abca13 UTSW 11 9621917 missense probably damaging 1.00
R5758:Abca13 UTSW 11 9314536 missense probably damaging 0.97
R5762:Abca13 UTSW 11 9581665 missense probably damaging 1.00
R5771:Abca13 UTSW 11 9291411 missense probably damaging 1.00
R5809:Abca13 UTSW 11 9293692 missense probably damaging 1.00
R5826:Abca13 UTSW 11 9682056 missense probably damaging 0.99
R5831:Abca13 UTSW 11 9567777 nonsense probably null
R5834:Abca13 UTSW 11 9277974 critical splice donor site probably null
R5902:Abca13 UTSW 11 9297177 missense probably damaging 1.00
R5933:Abca13 UTSW 11 9249658 missense possibly damaging 0.63
R5945:Abca13 UTSW 11 9293398 missense probably benign 0.04
R5969:Abca13 UTSW 11 9292214 nonsense probably null
R5985:Abca13 UTSW 11 9291628 missense probably benign 0.02
R5998:Abca13 UTSW 11 9567708 missense probably damaging 0.97
R6021:Abca13 UTSW 11 9290465 nonsense probably null
R6022:Abca13 UTSW 11 9290759 missense probably damaging 1.00
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6105:Abca13 UTSW 11 9397812 missense probably damaging 1.00
R6153:Abca13 UTSW 11 9301259 critical splice acceptor site probably null
R6162:Abca13 UTSW 11 9309047 missense probably damaging 1.00
R6187:Abca13 UTSW 11 9309085 missense probably damaging 1.00
R6247:Abca13 UTSW 11 9403874 missense probably benign 0.01
R6329:Abca13 UTSW 11 9277937 missense probably damaging 1.00
R6352:Abca13 UTSW 11 9309139 splice site probably null
R6367:Abca13 UTSW 11 9216248 missense possibly damaging 0.85
R6423:Abca13 UTSW 11 9298778 missense probably benign 0.01
R6424:Abca13 UTSW 11 9510542 missense probably benign
R6456:Abca13 UTSW 11 9290474 missense possibly damaging 0.94
R6490:Abca13 UTSW 11 9298661 missense probably benign 0.00
R6547:Abca13 UTSW 11 9274757 missense probably benign 0.04
R6594:Abca13 UTSW 11 9294632 missense possibly damaging 0.52
R6604:Abca13 UTSW 11 9378384 missense probably damaging 1.00
R6614:Abca13 UTSW 11 9294371 missense probably benign 0.04
R6736:Abca13 UTSW 11 9465058 missense probably damaging 1.00
R6742:Abca13 UTSW 11 9328168 missense probably damaging 1.00
R6791:Abca13 UTSW 11 9378504 missense probably damaging 1.00
R6834:Abca13 UTSW 11 9275110 missense possibly damaging 0.48
R6936:Abca13 UTSW 11 9298568 missense probably damaging 0.96
R6955:Abca13 UTSW 11 9294307 missense probably benign 0.28
X0013:Abca13 UTSW 11 9273899 missense probably benign 0.02
X0057:Abca13 UTSW 11 9294744 missense probably damaging 0.96
X0066:Abca13 UTSW 11 9267565 missense probably damaging 0.96
Z1088:Abca13 UTSW 11 9294687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGAGCCTTGACTCCAGCAAGAC -3'
(R):5'- GCTATCAGCCAAAGTGACCCAAGAG -3'

Sequencing Primer
(F):5'- CATTCAAAGAAAAAGAGCTTCACTTC -3'
(R):5'- GATCTTACATGCCAGCAACATGAC -3'
Protein Function and Prediction

Abca13 encodes ABCA13, a member of the ATP-binding cassette (ABC) transporter superfamily.  The members of the ABCA subfamily share a high degree of sequence conservation and function in lipid trafficking in several body locations [reviewed in (1)]. ABCA13 has two transmembrane domains, each with six membrane-spanning segments, and two nucleotide-binding domains located in the cytoplasm (2)

Expression/Localization

ABCA13 is expressed at high levels in the trachea, testis, and bone marrow. In the mouse, PCR analysis detected Abca13 is expressed in the kidney and skeletal muscle (2).

Background

Due to ubiquitous expression of Abca13 in blood-derived cells, a role associated with hematopoiesis has been suggested for ABCA13. However, the exact function and substrates for ABCA13 remain to be determined [reviewed in (1)]. 

 

ABCA13 was identified as a susceptibility factor for schizophrenia, bipolar disorder, and major depression (3). In humans, ABCA13 maps to chromosome 7p12.3, a region linked to Schwachman-Diamond syndrome, a genetic disorder affecting the pancreas, and a locus involved in T-cell tumor invasion and cancer metastasis [reviewed in (1)]. High levels of ABCA13 are found in leukemia, prostate tumor, and CNS tumor cell lines [reviewed in (1)]. 

References
Posted On2013-06-12
Science WriterAnne Murray