Incidental Mutation 'R0538:Scn8a'
ID49636
Institutional Source Beutler Lab
Gene Symbol Scn8a
Ensembl Gene ENSMUSG00000023033
Gene Namesodium channel, voltage-gated, type VIII, alpha
Synonymsmnd2, C630029C19Rik, nmf58, NMF335, mnd-2, seal, motor end-plate disease, nur14, Nav1.6, med, ataxia 3, nmf2, nmf335, NaCh6
MMRRC Submission 038730-MU
Accession Numbers

Genbank: NM_001077499, NM_011323; MGI: 103169

Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock #R0538 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100869858-101045938 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 101035624 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1570 (K1570*)
Ref Sequence ENSEMBL: ENSMUSP00000144013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082209] [ENSMUST00000108908] [ENSMUST00000108909] [ENSMUST00000108910] [ENSMUST00000200963] [ENSMUST00000201549]
Predicted Effect probably null
Transcript: ENSMUST00000082209
AA Change: K1570*
SMART Domains Protein: ENSMUSP00000080842
Gene: ENSMUSG00000023033
AA Change: K1570*

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108908
AA Change: K1570*
SMART Domains Protein: ENSMUSP00000104536
Gene: ENSMUSG00000023033
AA Change: K1570*

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 1.9e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Pfam:Ion_trans 451 640 1.1e-47 PFAM
Pfam:Na_trans_assoc 655 872 1.9e-71 PFAM
Pfam:Ion_trans 898 1127 4.4e-59 PFAM
PDB:1BYY|A 1129 1181 7e-30 PDB
Pfam:Ion_trans 1220 1429 1.9e-51 PFAM
Pfam:PKD_channel 1281 1436 5.6e-7 PFAM
IQ 1558 1580 1.2e-4 SMART
low complexity region 1619 1638 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108909
AA Change: K1580*
SMART Domains Protein: ENSMUSP00000104537
Gene: ENSMUSG00000023033
AA Change: K1580*

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 2.2e-76 PFAM
low complexity region 335 364 N/A INTRINSIC
Pfam:DUF3451 390 616 8.7e-70 PFAM
Pfam:Ion_trans 697 886 1.3e-47 PFAM
Pfam:Na_trans_assoc 901 1118 2.3e-71 PFAM
Pfam:Ion_trans 1144 1186 9.7e-10 PFAM
Pfam:Ion_trans 1182 1332 1.7e-31 PFAM
PDB:1BYY|A 1334 1386 2e-29 PDB
Pfam:Ion_trans 1425 1634 2.3e-51 PFAM
Pfam:PKD_channel 1486 1641 6.6e-7 PFAM
IQ 1763 1785 1.2e-4 SMART
low complexity region 1824 1843 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108910
AA Change: K1570*
SMART Domains Protein: ENSMUSP00000104538
Gene: ENSMUSG00000023033
AA Change: K1570*

DomainStartEndE-ValueType
Pfam:Ion_trans 160 410 2.5e-76 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:DUF3451 478 704 9.6e-70 PFAM
Pfam:Ion_trans 785 974 1.4e-47 PFAM
Pfam:Na_trans_assoc 989 1206 2.5e-71 PFAM
Pfam:Ion_trans 1232 1461 5.7e-59 PFAM
PDB:1BYY|A 1463 1515 4e-29 PDB
Pfam:Ion_trans 1554 1763 2.5e-51 PFAM
Pfam:PKD_channel 1615 1770 7.1e-7 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200963
AA Change: K1529*
SMART Domains Protein: ENSMUSP00000144371
Gene: ENSMUSG00000023033
AA Change: K1529*

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 4.1e-80 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 2.5e-69 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 1.2e-55 PFAM
Pfam:Na_trans_assoc 989 1191 9.1e-57 PFAM
Pfam:Ion_trans 1195 1274 7.6e-16 PFAM
Pfam:Ion_trans 1270 1431 2.6e-33 PFAM
Pfam:Ion_trans 1478 1734 6.5e-55 PFAM
IQ 1851 1873 6e-7 SMART
low complexity region 1912 1931 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201549
AA Change: K1570*
SMART Domains Protein: ENSMUSP00000144013
Gene: ENSMUSG00000023033
AA Change: K1570*

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (126/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
Allele List at MGI

 All alleles(22) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Transgenic(1) Spontaneous(5) Chemically induced(8)

Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik A T 14: 66,938,374 H6L unknown Het
Abca13 G A 11: 9,267,622 probably null Het
Acad12 C T 5: 121,607,448 R260Q possibly damaging Het
Actn1 G A 12: 80,260,100 probably benign Het
Acvrl1 A G 15: 101,136,149 T182A probably damaging Het
Adam23 T C 1: 63,567,844 probably benign Het
Adamtsl1 A T 4: 86,343,121 T1190S probably benign Het
Adh6b A T 3: 138,357,650 Y330F probably benign Het
Ak7 A G 12: 105,766,617 E540G probably damaging Het
Akr1c19 T A 13: 4,237,100 L106Q probably damaging Het
Ankrd12 A T 17: 66,049,852 S57T probably damaging Het
Aoc3 G A 11: 101,332,138 R400Q possibly damaging Het
Arel1 A T 12: 84,941,837 I46N probably damaging Het
Armc5 A G 7: 128,244,291 D752G probably damaging Het
Atp11b T C 3: 35,837,014 V812A probably damaging Het
Axin1 A G 17: 26,184,241 H131R possibly damaging Het
Bpifb3 A G 2: 153,923,869 E184G probably benign Het
Cacna2d2 T C 9: 107,524,383 probably benign Het
Catsperd T C 17: 56,662,828 F641L probably benign Het
Ccdc83 A C 7: 90,228,383 L284V probably damaging Het
Ccnt2 T A 1: 127,803,165 V593E probably damaging Het
Cd53 T A 3: 106,762,128 I185F probably benign Het
Cep350 A T 1: 155,848,620 D3077E possibly damaging Het
Ces1h C A 8: 93,357,000 probably null Het
Chrna3 T A 9: 55,016,006 T173S probably benign Het
Clca4b T C 3: 144,921,956 D418G probably benign Het
Col11a2 T C 17: 34,051,328 probably benign Het
Coq2 T A 5: 100,668,023 I97F possibly damaging Het
Cr2 A G 1: 195,160,359 probably benign Het
Ctgf T A 10: 24,596,466 C136S probably damaging Het
D2hgdh A G 1: 93,826,377 Y24C probably damaging Het
D630045J12Rik G A 6: 38,191,693 R974C probably damaging Het
Dach1 A G 14: 97,903,279 V429A possibly damaging Het
Ddr1 G A 17: 35,685,007 T660I probably damaging Het
Dlg1 A C 16: 31,796,864 probably null Het
Dmbt1 T C 7: 131,049,901 probably benign Het
Dmxl2 A T 9: 54,393,836 D2330E probably benign Het
Doc2a A G 7: 126,848,811 T5A probably benign Het
Dock2 G A 11: 34,704,718 probably benign Het
Dok4 T A 8: 94,865,238 Y290F probably damaging Het
Dopey1 A G 9: 86,485,497 D11G probably damaging Het
E230025N22Rik T C 18: 36,688,934 H235R probably benign Het
Ear6 A G 14: 51,854,452 D152G probably damaging Het
Ecscr T A 18: 35,713,636 probably benign Het
Eml6 A T 11: 29,760,010 probably benign Het
Epha4 T A 1: 77,388,541 Q607L probably damaging Het
Exoc4 A G 6: 33,972,063 N947S probably benign Het
Flg A G 3: 93,279,460 E73G probably damaging Het
Fndc1 C T 17: 7,784,341 probably benign Het
Gad1-ps T C 10: 99,444,992 noncoding transcript Het
Gata6 A G 18: 11,064,771 T528A probably benign Het
Gjd4 T C 18: 9,280,244 E278G probably benign Het
Gm13101 T A 4: 143,965,083 T357S possibly damaging Het
Gm20091 T A 10: 96,409,002 noncoding transcript Het
Gnb3 G A 6: 124,835,696 Q266* probably null Het
Grm3 A G 5: 9,512,446 V468A possibly damaging Het
Igf1r C T 7: 68,207,826 R1085C probably damaging Het
Igsf10 T C 3: 59,320,106 T2049A probably damaging Het
Jak3 A T 8: 71,685,482 D859V probably benign Het
Kcnb2 G T 1: 15,712,884 probably benign Het
Kcnh3 G A 15: 99,240,958 G858D probably benign Het
Kif1a C A 1: 93,043,638 R1006L probably damaging Het
Klhl23 C T 2: 69,824,413 A209V probably benign Het
Mapk13 T C 17: 28,775,255 Y104H probably damaging Het
Mbd4 A G 6: 115,849,482 S183P probably damaging Het
Mga T C 2: 119,919,706 probably null Het
Mipol1 G A 12: 57,414,411 probably null Het
Mmp14 A G 14: 54,438,709 T299A possibly damaging Het
Mmrn1 A G 6: 60,976,469 E578G probably benign Het
Mov10l1 G A 15: 88,994,860 C193Y possibly damaging Het
Mppe1 A G 18: 67,237,477 C50R probably damaging Het
Msantd1 C A 5: 34,917,725 R44S probably damaging Het
Myt1l T C 12: 29,842,571 V69A possibly damaging Het
Nav1 A T 1: 135,464,692 probably benign Het
Ncan A G 8: 70,108,602 S572P possibly damaging Het
Nck2 T C 1: 43,569,144 probably benign Het
Nemf A T 12: 69,356,314 D31E probably damaging Het
Nlrp12 T C 7: 3,249,262 D93G possibly damaging Het
Nsmaf A T 4: 6,419,930 probably null Het
Nup98 T C 7: 102,186,685 T184A probably damaging Het
Olfr1415 A T 1: 92,491,333 C141S possibly damaging Het
Olfr46 A T 7: 140,610,384 N73Y probably damaging Het
Olfr522 A T 7: 140,162,231 S240T probably damaging Het
Oog2 C A 4: 144,196,084 Y306* probably null Het
Osmr A G 15: 6,841,938 probably benign Het
P2rx6 A G 16: 17,568,298 N275S probably benign Het
Papd4 A T 13: 93,175,615 probably benign Het
Pbxip1 G T 3: 89,447,619 G482W possibly damaging Het
Pcsk4 T G 10: 80,325,334 I249L probably damaging Het
Pou4f2 C T 8: 78,435,662 G104E probably damaging Het
Prkdc G T 16: 15,833,788 R3763L probably damaging Het
Ptpre A T 7: 135,663,315 I207F probably damaging Het
Rapgef3 A T 15: 97,757,817 probably benign Het
Rasgrp1 T G 2: 117,284,947 K685T probably benign Het
Rnf148 C T 6: 23,654,238 R253Q probably damaging Het
Rock1 T C 18: 10,132,227 I241V possibly damaging Het
Rp1l1 T G 14: 64,022,092 V61G probably damaging Het
Scin A C 12: 40,081,771 S255A probably damaging Het
Sec14l4 A C 11: 4,040,018 M106L probably benign Het
Sec63 G A 10: 42,798,799 R226H probably benign Het
Sept2 T A 1: 93,501,623 N271K probably damaging Het
Serac1 G T 17: 6,048,826 probably benign Het
Shc2 T A 10: 79,630,140 probably benign Het
Sipa1l1 T A 12: 82,425,099 D1284E probably benign Het
Slc11a2 A G 15: 100,408,216 L105P probably damaging Het
Slc1a3 T A 15: 8,650,922 T151S probably benign Het
Smarca2 G T 19: 26,691,362 K920N probably damaging Het
Sugp2 G A 8: 70,258,948 E964K probably damaging Het
Tas2r122 A C 6: 132,711,815 N38K probably benign Het
Tecpr1 G A 5: 144,206,274 R730C probably damaging Het
Themis3 G T 17: 66,593,270 N34K possibly damaging Het
Traf3ip1 A G 1: 91,499,619 T104A unknown Het
Trappc11 A G 8: 47,503,412 V843A probably benign Het
Trmt61a T A 12: 111,678,927 L99Q probably damaging Het
Trp53tg5 T A 2: 164,471,481 K91N probably damaging Het
Ufsp2 T C 8: 45,992,150 S339P probably damaging Het
Usp20 T A 2: 31,004,450 V126E probably damaging Het
Vmn1r75 T A 7: 11,880,870 N176K probably damaging Het
Vmn2r24 A G 6: 123,816,053 S780G probably benign Het
Vmn2r89 A G 14: 51,457,591 probably null Het
Vps13d A T 4: 145,045,095 S4038T probably damaging Het
Vwa7 A G 17: 35,022,651 T421A probably damaging Het
Wdr78 T C 4: 103,096,618 N128S possibly damaging Het
Wdr95 C A 5: 149,580,806 L332I probably damaging Het
Wrn T A 8: 33,336,091 K181I probably damaging Het
Zc3h6 T A 2: 129,017,223 I1058N possibly damaging Het
Zfp423 T A 8: 87,782,085 I544F probably damaging Het
Zfp446 T A 7: 12,979,589 S161T possibly damaging Het
Zmym6 T A 4: 127,123,369 M889K probably benign Het
Other mutations in Scn8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Scn8a APN 15 100955532 unclassified probably benign
IGL00979:Scn8a APN 15 100955406 unclassified probably benign
IGL01339:Scn8a APN 15 101032201 missense probably benign
IGL01992:Scn8a APN 15 100969057 missense probably damaging 1.00
IGL02215:Scn8a APN 15 101029572 splice site probably null
IGL02311:Scn8a APN 15 101013283 missense probably damaging 0.97
IGL02404:Scn8a APN 15 101039730 missense probably damaging 1.00
IGL02652:Scn8a APN 15 101013476 missense probably damaging 0.98
IGL02690:Scn8a APN 15 100970254 missense probably damaging 1.00
IGL02704:Scn8a APN 15 101008062 missense possibly damaging 0.94
IGL03084:Scn8a APN 15 101017172 missense probably damaging 1.00
IGL03108:Scn8a APN 15 100974615 missense probably benign
IGL03224:Scn8a APN 15 101035639 missense probably damaging 1.00
dan UTSW 15 101035624 nonsense probably null
nymph UTSW 15 101035646 missense probably damaging 1.00
Tremord UTSW 15 101013504 missense probably damaging 1.00
3-1:Scn8a UTSW 15 101039939 missense probably benign 0.04
PIT4280001:Scn8a UTSW 15 100957489 missense probably damaging 1.00
PIT4508001:Scn8a UTSW 15 101029692 missense probably damaging 0.98
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0254:Scn8a UTSW 15 101018364 missense probably damaging 1.00
R0412:Scn8a UTSW 15 101008306 splice site probably benign
R0539:Scn8a UTSW 15 101016568 missense probably damaging 1.00
R0631:Scn8a UTSW 15 101035537 missense probably damaging 1.00
R0726:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R0945:Scn8a UTSW 15 101015787 missense possibly damaging 0.54
R0967:Scn8a UTSW 15 101035646 missense probably damaging 1.00
R1164:Scn8a UTSW 15 101040162 missense probably benign 0.06
R1283:Scn8a UTSW 15 100969171 missense possibly damaging 0.82
R1368:Scn8a UTSW 15 101035541 missense probably damaging 1.00
R1633:Scn8a UTSW 15 101029815 missense probably benign 0.01
R1669:Scn8a UTSW 15 101011120 missense probably damaging 1.00
R1694:Scn8a UTSW 15 100955528 nonsense probably null
R1735:Scn8a UTSW 15 101015861 missense possibly damaging 0.94
R1773:Scn8a UTSW 15 101039615 missense probably damaging 0.97
R1940:Scn8a UTSW 15 100970204 missense probably benign 0.22
R1996:Scn8a UTSW 15 101024379 missense probably damaging 1.00
R2107:Scn8a UTSW 15 101018363 missense probably damaging 0.99
R2251:Scn8a UTSW 15 101017106 missense probably benign 0.02
R2516:Scn8a UTSW 15 100969162 missense probably benign 0.05
R2917:Scn8a UTSW 15 101039732 missense probably damaging 1.00
R3417:Scn8a UTSW 15 100971668 splice site probably benign
R3896:Scn8a UTSW 15 101035498 missense probably benign
R4024:Scn8a UTSW 15 101039793 missense probably damaging 1.00
R4050:Scn8a UTSW 15 101013413 nonsense probably null
R4193:Scn8a UTSW 15 100971603 missense probably damaging 1.00
R4212:Scn8a UTSW 15 100957073 missense possibly damaging 0.88
R4358:Scn8a UTSW 15 100940133 missense probably benign 0.00
R4396:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R4428:Scn8a UTSW 15 100983903 missense probably damaging 1.00
R4452:Scn8a UTSW 15 100957091 missense possibly damaging 0.95
R4631:Scn8a UTSW 15 101016503 nonsense probably null
R4693:Scn8a UTSW 15 101015691 missense probably damaging 1.00
R4765:Scn8a UTSW 15 101040471 missense probably benign 0.07
R4777:Scn8a UTSW 15 101015951 missense probably damaging 1.00
R4949:Scn8a UTSW 15 101029782 missense probably damaging 1.00
R4997:Scn8a UTSW 15 100957054 missense probably damaging 1.00
R5246:Scn8a UTSW 15 101011057 missense probably damaging 1.00
R5566:Scn8a UTSW 15 100974534 missense probably damaging 1.00
R5875:Scn8a UTSW 15 100972822 nonsense probably null
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6057:Scn8a UTSW 15 100974667 missense possibly damaging 0.94
R6114:Scn8a UTSW 15 101040596 missense probably damaging 0.99
R6362:Scn8a UTSW 15 100940115 unclassified probably null
R6535:Scn8a UTSW 15 100959707 intron probably benign
R6677:Scn8a UTSW 15 100969072 missense probably damaging 1.00
R6687:Scn8a UTSW 15 100974627 missense probably benign 0.12
R6701:Scn8a UTSW 15 101040096 missense probably damaging 1.00
R6719:Scn8a UTSW 15 101011015 critical splice acceptor site probably null
R6739:Scn8a UTSW 15 101015955 missense possibly damaging 0.82
R6769:Scn8a UTSW 15 101035564 missense probably benign
R6786:Scn8a UTSW 15 101032215 missense probably benign 0.00
R6849:Scn8a UTSW 15 100955587 intron probably null
R7108:Scn8a UTSW 15 101039778 missense probably benign 0.01
R7215:Scn8a UTSW 15 101029830 missense possibly damaging 0.80
R7217:Scn8a UTSW 15 100970227 missense probably benign 0.00
R7219:Scn8a UTSW 15 100969103 missense probably damaging 1.00
R7356:Scn8a UTSW 15 100957579 missense probably damaging 1.00
R7479:Scn8a UTSW 15 100955477 missense probably damaging 0.99
X0066:Scn8a UTSW 15 101040080 missense probably damaging 1.00
X0066:Scn8a UTSW 15 101040081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGTCACGCAACAAGCCTTCG -3'
(R):5'- GCTCTCAGAAATCTGGTCCTCACAC -3'

Sequencing Primer
(F):5'- ACAAGCCTTCGACATCGTG -3'
(R):5'- TCCTCACACCTGGGGTC -3'
Posted On2013-06-12