Incidental Mutation 'R0539:Robo2'
ID49743
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
MMRRC Submission 038731-MU
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R0539 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 73985574 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478] [ENSMUST00000227347]
Predicted Effect
SMART Domains Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 330 402 1.3e-11 SMART
IGc2 434 499 3.73e-12 SMART
FN3 526 608 1.42e-15 SMART
FN3 640 725 3.54e-2 SMART
FN3 740 827 6.15e-11 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 1044 1069 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117200
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117785
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147408
Predicted Effect probably benign
Transcript: ENSMUST00000226478
Predicted Effect probably benign
Transcript: ENSMUST00000227347
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (107/107)
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730480H06Rik T A 5: 48,379,350 H129Q probably damaging Het
Abca14 G A 7: 120,207,797 R22Q probably damaging Het
Abcg5 T A 17: 84,669,075 M445L probably benign Het
Abhd3 T A 18: 10,645,208 N357I possibly damaging Het
Adamts5 C T 16: 85,868,692 G574S probably damaging Het
Adgrg5 T A 8: 94,938,632 N389K probably damaging Het
Ankk1 A G 9: 49,418,030 V80A probably benign Het
Arhgap20 A G 9: 51,850,155 Q1066R probably benign Het
Arhgap21 T A 2: 20,914,799 K32* probably null Het
AW209491 T C 13: 14,637,732 F390S probably damaging Het
Axl A T 7: 25,778,717 probably benign Het
Bri3bp A G 5: 125,454,539 Y183C probably damaging Het
Cad T C 5: 31,075,457 probably benign Het
Capns2 A G 8: 92,901,732 Q83R possibly damaging Het
Ccdc180 G T 4: 45,922,010 R1028L probably damaging Het
Cdh19 C A 1: 110,925,162 V348F possibly damaging Het
Chrm2 T C 6: 36,523,706 V166A possibly damaging Het
Clmp A G 9: 40,782,486 Y333C probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Copz1 A G 15: 103,291,365 Y69C probably damaging Het
Crybg1 T C 10: 43,998,898 D738G probably benign Het
Ctnna2 T A 6: 76,973,899 I165F probably damaging Het
Dcaf7 T G 11: 106,051,826 S200A probably damaging Het
Deup1 T A 9: 15,582,597 R416S possibly damaging Het
Dmxl1 T A 18: 49,857,430 probably benign Het
Dnase2b A T 3: 146,589,155 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Ephb2 T C 4: 136,655,976 Y931C probably damaging Het
Fam83h T C 15: 76,003,227 S754G possibly damaging Het
Fibp T A 19: 5,463,188 V177D probably damaging Het
Gfpt2 T C 11: 49,832,898 I571T probably damaging Het
Grm7 T G 6: 111,359,094 probably benign Het
Gsdma3 A G 11: 98,635,919 Y335C probably damaging Het
H2-T23 A T 17: 36,032,141 probably benign Het
Hist1h4c A G 13: 23,698,148 F101S probably damaging Het
Hydin A G 8: 110,523,072 I2216V probably benign Het
Ipo8 A G 6: 148,818,108 M113T probably benign Het
Kdm6a A G X: 18,262,425 E1045G probably damaging Het
Kyat1 C T 2: 30,188,217 E117K probably damaging Het
Lin7b A G 7: 45,369,902 probably benign Het
Lipn G A 19: 34,084,603 probably benign Het
Lrfn2 C A 17: 49,071,044 N384K probably damaging Het
Lrrc6 A T 15: 66,447,606 V305D probably damaging Het
Map1b T C 13: 99,434,018 K732E unknown Het
Mpl A G 4: 118,443,508 M541T possibly damaging Het
Mprip T C 11: 59,741,117 probably benign Het
Mrc1 T C 2: 14,270,126 probably benign Het
Ms4a13 T C 19: 11,171,871 probably benign Het
Myo18b G T 5: 112,723,868 R2116S probably damaging Het
Nav2 A G 7: 49,461,938 T731A probably damaging Het
Ncoa6 G T 2: 155,415,697 A642D probably benign Het
Ndufs7 T A 10: 80,254,831 probably benign Het
Nfkbiz G A 16: 55,817,879 T406M probably benign Het
Nr4a1 A G 15: 101,270,884 E267G probably damaging Het
Nrxn2 T G 19: 6,493,404 F1103V probably damaging Het
Olfr1028 G T 2: 85,952,009 M315I probably benign Het
Olfr1044 A T 2: 86,171,043 M258K probably damaging Het
Olfr1441 C T 19: 12,422,809 L167F probably damaging Het
Olfr381 T C 11: 73,486,063 T254A probably benign Het
Olfr479 C T 7: 108,055,822 T280I probably damaging Het
Olfr958 A T 9: 39,550,297 D191E probably damaging Het
Olfr996 T A 2: 85,579,775 C179S probably damaging Het
Phf1 A G 17: 26,934,458 probably null Het
Pip C T 6: 41,849,885 Q53* probably null Het
Ppp2ca T C 11: 52,118,162 probably null Het
Prl2c5 A G 13: 13,189,321 probably null Het
Psph T A 5: 129,766,577 probably benign Het
Ptch1 C T 13: 63,543,480 probably benign Het
Ptprs C T 17: 56,458,255 V10M probably damaging Het
Rarg T C 15: 102,238,877 R358G probably damaging Het
Rbl2 T C 8: 91,112,505 probably benign Het
Scin A T 12: 40,081,766 D256E possibly damaging Het
Scn8a T C 15: 101,016,568 Y1152H probably damaging Het
Sh2b2 T G 5: 136,225,301 probably benign Het
Slc13a2 G A 11: 78,399,138 P450L probably damaging Het
Slc2a12 A G 10: 22,692,230 I519V probably benign Het
Slc30a9 C T 5: 67,334,610 T260M probably damaging Het
Slc9a7 A T X: 20,202,762 F184Y probably damaging Het
Smc2 G T 4: 52,458,558 K466N probably benign Het
Snx16 T C 3: 10,426,218 E209G probably damaging Het
Sp3 A T 2: 72,970,532 I423N possibly damaging Het
Ssh2 G T 11: 77,454,794 V1202F probably benign Het
Stam2 A T 2: 52,703,256 probably benign Het
Stox2 T C 8: 47,194,035 Y194C probably damaging Het
Sult3a1 A G 10: 33,866,523 T49A probably damaging Het
Supt3 A T 17: 45,003,131 I136F possibly damaging Het
Syne2 A T 12: 76,024,121 R103S possibly damaging Het
Synj2 T A 17: 5,996,888 M1K probably null Het
Tas2r110 T C 6: 132,868,371 S122P possibly damaging Het
Tln1 A G 4: 43,543,434 probably null Het
Tmem117 A G 15: 94,714,912 T110A possibly damaging Het
Tmem247 A G 17: 86,917,478 D5G probably benign Het
Tmem39a T A 16: 38,590,975 F363I probably benign Het
Tmem80 G A 7: 141,335,895 A73T possibly damaging Het
Trpm4 C T 7: 45,305,472 G901S probably damaging Het
Upk3bl T C 5: 136,063,986 probably benign Het
Vmn1r120 A T 7: 21,053,472 C105S probably damaging Het
Vmn1r69 A T 7: 10,580,947 probably benign Het
Vmn2r95 T C 17: 18,452,100 F700L probably damaging Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Zbtb22 A G 17: 33,918,144 D421G possibly damaging Het
Zbtb45 G A 7: 13,006,333 R452C probably damaging Het
Zfhx3 T C 8: 108,800,509 Y1013H probably damaging Het
Zfp329 C T 7: 12,806,593 probably null Het
Zfp532 T A 18: 65,623,766 S257T probably benign Het
Zfp933 G A 4: 147,826,548 T197I probably benign Het
Zgrf1 T A 3: 127,615,192 N1649K probably damaging Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0324:Robo2 UTSW 16 73967851 missense probably damaging 1.00
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1422:Robo2 UTSW 16 73978448 missense probably damaging 0.99
R1452:Robo2 UTSW 16 73961910 missense probably damaging 1.00
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4426:Robo2 UTSW 16 73948266 missense probably damaging 1.00
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5447:Robo2 UTSW 16 73973766 nonsense probably null
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5646:Robo2 UTSW 16 73961819 missense probably damaging 0.99
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6126:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6919:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense probably damaging 1.00
R7092:Robo2 UTSW 16 73956643 missense probably damaging 0.99
R7136:Robo2 UTSW 16 73956550 missense probably damaging 0.99
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGAAAGCAACATGACTATTGCTG -3'
(R):5'- TGAAGACACGGGATGCTAATGTGC -3'

Sequencing Primer
(F):5'- GCTGTCAGAAATTTTCAATATCGTTG -3'
(R):5'- AAGGTGACCTAGCCTTGCTC -3'
Posted On2013-06-12