Incidental Mutation 'R0542:Crispld1'
ID49952
Institutional Source Beutler Lab
Gene Symbol Crispld1
Ensembl Gene ENSMUSG00000025776
Gene Namecysteine-rich secretory protein LCCL domain containing 1
SynonymsCocoacrisp
MMRRC Submission 038734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0542 (G1)
Quality Score218
Status Validated
Chromosome1
Chromosomal Location17727045-17766344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17746768 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 183 (V183A)
Ref Sequence ENSEMBL: ENSMUSP00000124095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095075] [ENSMUST00000159958] [ENSMUST00000160305]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095075
AA Change: V183A

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092686
Gene: ENSMUSG00000025776
AA Change: V183A

DomainStartEndE-ValueType
SCP 60 214 1.63e-41 SMART
LCCL 291 375 1.6e-52 SMART
LCCL 392 483 1.55e-59 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159958
AA Change: V183A

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124095
Gene: ENSMUSG00000025776
AA Change: V183A

DomainStartEndE-ValueType
SCP 60 214 1.63e-41 SMART
LCCL 291 375 1.6e-52 SMART
LCCL 392 483 1.55e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160305
SMART Domains Protein: ENSMUSP00000123800
Gene: ENSMUSG00000025776

DomainStartEndE-ValueType
SCP 60 162 1.26e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189853
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,782,172 N22S probably benign Het
Abhd12b C A 12: 70,163,495 N71K possibly damaging Het
Adgrl2 A G 3: 148,859,218 I242T probably damaging Het
Adgrv1 A G 13: 81,573,318 S714P probably damaging Het
Agap3 G A 5: 24,500,186 R704Q possibly damaging Het
Ankrd11 T C 8: 122,895,770 R448G probably damaging Het
Anks1b T C 10: 90,073,967 probably benign Het
Caml A T 13: 55,623,161 Q24L possibly damaging Het
Cdc14b G A 13: 64,243,683 T124I probably benign Het
Clca2 A G 3: 145,075,810 probably benign Het
Col12a1 A G 9: 79,605,328 probably null Het
Dhx40 C T 11: 86,804,256 probably null Het
Dmxl1 T A 18: 49,893,694 D1956E probably benign Het
Dsc2 A G 18: 20,051,226 V35A probably damaging Het
Dusp27 A T 1: 166,101,284 M253K possibly damaging Het
Elovl2 A G 13: 41,191,976 probably benign Het
Gapvd1 T C 2: 34,725,036 probably benign Het
Gnaq T A 19: 16,219,618 I56N probably damaging Het
Gpr139 T C 7: 119,145,083 D93G probably benign Het
Hars C T 18: 36,771,181 R215H probably benign Het
Helz2 C A 2: 181,232,089 W2204L probably damaging Het
Itgb6 A T 2: 60,605,136 C757S possibly damaging Het
Kpnb1 G A 11: 97,187,572 T5I probably benign Het
Krt82 T C 15: 101,545,600 probably benign Het
Lgals9 T A 11: 78,969,720 K175N possibly damaging Het
Lrp2 A G 2: 69,428,654 I4564T probably benign Het
Mblac1 A G 5: 138,194,536 T47A possibly damaging Het
Med12l G A 3: 59,042,401 D182N probably damaging Het
Megf9 A G 4: 70,435,348 I407T probably benign Het
Mtmr6 A T 14: 60,292,129 probably null Het
Mtor A G 4: 148,540,450 T2173A probably benign Het
Mzt1 A T 14: 99,040,502 probably benign Het
Narf T C 11: 121,252,864 L444P probably damaging Het
Nsd1 A T 13: 55,260,458 Q1305L possibly damaging Het
Ntsr1 A G 2: 180,542,581 Y359C probably damaging Het
Olfm1 A G 2: 28,214,628 D159G possibly damaging Het
Olfr168 A T 16: 19,529,982 *313R probably null Het
Pcdh1 C T 18: 38,189,922 V953I probably damaging Het
Pcdhb11 A T 18: 37,423,834 D739V probably damaging Het
Pdgfd A G 9: 6,359,769 N280S probably damaging Het
Per2 A T 1: 91,438,332 probably null Het
Pfkp G T 13: 6,621,992 C122* probably null Het
Plxna4 G A 6: 32,192,297 R1322W probably damaging Het
Ppox A G 1: 171,279,244 L202P probably damaging Het
Ppp1r3e G A 14: 54,877,131 P58L probably benign Het
Prr23a2 A C 9: 98,857,033 N148T probably benign Het
Psd T C 19: 46,314,210 T842A probably damaging Het
Ranbp2 C T 10: 58,478,414 A1652V probably benign Het
Rragd G A 4: 33,007,103 V144M probably damaging Het
Sema6a T G 18: 47,248,576 D968A probably damaging Het
Slc30a5 A T 13: 100,809,285 probably null Het
Snx17 G T 5: 31,196,551 probably null Het
Syt14 G T 1: 192,930,803 T563K probably damaging Het
Tada3 T C 6: 113,375,214 K85E probably damaging Het
Tspear T C 10: 77,881,087 V532A probably benign Het
Ttc30b A G 2: 75,936,711 V566A probably damaging Het
Ttn A T 2: 76,893,109 C6426S possibly damaging Het
Unc79 T C 12: 103,094,178 probably benign Het
Usp19 A G 9: 108,494,385 probably null Het
Vav3 G A 3: 109,527,430 D426N probably damaging Het
Vezt T C 10: 94,007,096 probably null Het
Vldlr G T 19: 27,236,255 R114L probably benign Het
Wdr34 A G 2: 30,031,825 V508A probably damaging Het
Wwc2 C T 8: 47,868,379 V567I unknown Het
Zfp423 T C 8: 87,780,609 T911A probably damaging Het
Zfp719 A G 7: 43,589,253 probably null Het
Zkscan16 A T 4: 58,956,597 H293L possibly damaging Het
Zkscan6 A C 11: 65,828,699 N515T possibly damaging Het
Znfx1 A G 2: 167,055,655 S450P probably damaging Het
Other mutations in Crispld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Crispld1 APN 1 17746801 missense probably benign 0.21
IGL01610:Crispld1 APN 1 17746725 splice site probably null
IGL01991:Crispld1 APN 1 17753017 missense probably benign
IGL02004:Crispld1 APN 1 17747520 missense probably damaging 1.00
IGL02178:Crispld1 APN 1 17762103 splice site probably benign
IGL02200:Crispld1 APN 1 17750333 unclassified probably benign
IGL02251:Crispld1 APN 1 17728840 missense probably benign 0.06
IGL02506:Crispld1 APN 1 17756305 missense probably damaging 0.99
IGL02883:Crispld1 APN 1 17746789 missense possibly damaging 0.87
IGL03310:Crispld1 APN 1 17745477 splice site probably benign
milliliter UTSW 1 17750801 missense possibly damaging 0.81
spoonful UTSW 1 17762141 missense probably damaging 1.00
R0068:Crispld1 UTSW 1 17752988 missense possibly damaging 0.89
R0324:Crispld1 UTSW 1 17749591 missense probably benign
R1117:Crispld1 UTSW 1 17749622 missense probably benign 0.03
R1157:Crispld1 UTSW 1 17745363 missense possibly damaging 0.70
R1585:Crispld1 UTSW 1 17750800 missense possibly damaging 0.68
R1630:Crispld1 UTSW 1 17728798 missense probably benign
R2081:Crispld1 UTSW 1 17762179 missense probably damaging 0.99
R2143:Crispld1 UTSW 1 17749636 missense probably benign
R2472:Crispld1 UTSW 1 17745828 missense probably null 0.12
R2520:Crispld1 UTSW 1 17750776 missense probably damaging 1.00
R4476:Crispld1 UTSW 1 17747510 missense probably damaging 1.00
R4486:Crispld1 UTSW 1 17752878 missense probably benign 0.01
R4779:Crispld1 UTSW 1 17749607 missense probably benign
R5508:Crispld1 UTSW 1 17752983 missense probably damaging 1.00
R5568:Crispld1 UTSW 1 17750271 missense probably benign 0.01
R6155:Crispld1 UTSW 1 17753017 missense probably benign
R6252:Crispld1 UTSW 1 17749507 missense probably benign 0.00
R6361:Crispld1 UTSW 1 17762231 missense probably damaging 0.99
R6617:Crispld1 UTSW 1 17728662 missense probably benign 0.02
R6760:Crispld1 UTSW 1 17750801 missense possibly damaging 0.81
R6961:Crispld1 UTSW 1 17762141 missense probably damaging 1.00
R7278:Crispld1 UTSW 1 17752878 missense probably benign 0.01
R7403:Crispld1 UTSW 1 17747596 missense probably damaging 1.00
Z1088:Crispld1 UTSW 1 17764076 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGCATGAATGATCTGTCTGGTCTT -3'
(R):5'- AGTCCGCTGCATTTACACATTGACTT -3'

Sequencing Primer
(F):5'- ATGATCTGTCTGGTCTTCTGTAGTTC -3'
(R):5'- GCATTTCAGCAACTATAATTACTGCC -3'
Posted On2013-06-12