Incidental Mutation 'R0542:Ppox'
ID49955
Institutional Source Beutler Lab
Gene Symbol Ppox
Ensembl Gene ENSMUSG00000062729
Gene Nameprotoporphyrinogen oxidase
Synonyms
MMRRC Submission 038734-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R0542 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171275990-171281186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171279244 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 202 (L202P)
Ref Sequence ENSEMBL: ENSMUSP00000141835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064272] [ENSMUST00000065941] [ENSMUST00000073120] [ENSMUST00000111305] [ENSMUST00000111306] [ENSMUST00000111313] [ENSMUST00000126699] [ENSMUST00000149187] [ENSMUST00000151863] [ENSMUST00000192956]
Predicted Effect probably benign
Transcript: ENSMUST00000064272
SMART Domains Protein: ENSMUSP00000066353
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 212 1.7e-59 PFAM
Pfam:Glyco_transf_7C 217 294 6.3e-32 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065941
SMART Domains Protein: ENSMUSP00000064002
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073120
AA Change: L229P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729
AA Change: L229P

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111305
SMART Domains Protein: ENSMUSP00000106936
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111306
SMART Domains Protein: ENSMUSP00000106938
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 559 4.1e-60 PFAM
Pfam:UCH_1 215 541 3.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111313
SMART Domains Protein: ENSMUSP00000106945
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 214 2.1e-74 PFAM
Pfam:Glyco_transf_7C 217 294 1.7e-31 PFAM
Pfam:Glyco_tranf_2_2 238 298 1e-6 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126557
Predicted Effect probably benign
Transcript: ENSMUST00000126699
SMART Domains Protein: ENSMUSP00000141958
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 1 72 3.2e-28 PFAM
Pfam:Glyco_tranf_2_2 16 76 2.1e-5 PFAM
low complexity region 126 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147176
Predicted Effect probably benign
Transcript: ENSMUST00000149187
SMART Domains Protein: ENSMUSP00000120161
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 438 1e-36 PFAM
Pfam:UCH_1 212 436 2.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151442
Predicted Effect probably benign
Transcript: ENSMUST00000151863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155083
Predicted Effect probably damaging
Transcript: ENSMUST00000192956
AA Change: L202P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729
AA Change: L202P

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Meta Mutation Damage Score 0.44 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the penultimate enzyme of heme biosynthesis, which catalyzes the 6-electron oxidation of protoporphyrinogen IX to form protoporphyrin IX. Mutations in this gene cause variegate porphyria, an autosomal dominant disorder of heme metabolism resulting from a deficiency in protoporphyrinogen oxidase, an enzyme located on the inner mitochondrial membrane. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for the R59W knock-in mutation exhibit elevated stool porphyrin levels and reduced hepatic protoporphyrinogen oxidase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,782,172 N22S probably benign Het
Abhd12b C A 12: 70,163,495 N71K possibly damaging Het
Adgrl2 A G 3: 148,859,218 I242T probably damaging Het
Adgrv1 A G 13: 81,573,318 S714P probably damaging Het
Agap3 G A 5: 24,500,186 R704Q possibly damaging Het
Ankrd11 T C 8: 122,895,770 R448G probably damaging Het
Anks1b T C 10: 90,073,967 probably benign Het
Caml A T 13: 55,623,161 Q24L possibly damaging Het
Cdc14b G A 13: 64,243,683 T124I probably benign Het
Clca2 A G 3: 145,075,810 probably benign Het
Col12a1 A G 9: 79,605,328 probably null Het
Crispld1 T C 1: 17,746,768 V183A possibly damaging Het
Dhx40 C T 11: 86,804,256 probably null Het
Dmxl1 T A 18: 49,893,694 D1956E probably benign Het
Dsc2 A G 18: 20,051,226 V35A probably damaging Het
Dusp27 A T 1: 166,101,284 M253K possibly damaging Het
Elovl2 A G 13: 41,191,976 probably benign Het
Gapvd1 T C 2: 34,725,036 probably benign Het
Gnaq T A 19: 16,219,618 I56N probably damaging Het
Gpr139 T C 7: 119,145,083 D93G probably benign Het
Hars C T 18: 36,771,181 R215H probably benign Het
Helz2 C A 2: 181,232,089 W2204L probably damaging Het
Itgb6 A T 2: 60,605,136 C757S possibly damaging Het
Kpnb1 G A 11: 97,187,572 T5I probably benign Het
Krt82 T C 15: 101,545,600 probably benign Het
Lgals9 T A 11: 78,969,720 K175N possibly damaging Het
Lrp2 A G 2: 69,428,654 I4564T probably benign Het
Mblac1 A G 5: 138,194,536 T47A possibly damaging Het
Med12l G A 3: 59,042,401 D182N probably damaging Het
Megf9 A G 4: 70,435,348 I407T probably benign Het
Mtmr6 A T 14: 60,292,129 probably null Het
Mtor A G 4: 148,540,450 T2173A probably benign Het
Mzt1 A T 14: 99,040,502 probably benign Het
Narf T C 11: 121,252,864 L444P probably damaging Het
Nsd1 A T 13: 55,260,458 Q1305L possibly damaging Het
Ntsr1 A G 2: 180,542,581 Y359C probably damaging Het
Olfm1 A G 2: 28,214,628 D159G possibly damaging Het
Olfr168 A T 16: 19,529,982 *313R probably null Het
Pcdh1 C T 18: 38,189,922 V953I probably damaging Het
Pcdhb11 A T 18: 37,423,834 D739V probably damaging Het
Pdgfd A G 9: 6,359,769 N280S probably damaging Het
Per2 A T 1: 91,438,332 probably null Het
Pfkp G T 13: 6,621,992 C122* probably null Het
Plxna4 G A 6: 32,192,297 R1322W probably damaging Het
Ppp1r3e G A 14: 54,877,131 P58L probably benign Het
Prr23a2 A C 9: 98,857,033 N148T probably benign Het
Psd T C 19: 46,314,210 T842A probably damaging Het
Ranbp2 C T 10: 58,478,414 A1652V probably benign Het
Rragd G A 4: 33,007,103 V144M probably damaging Het
Sema6a T G 18: 47,248,576 D968A probably damaging Het
Slc30a5 A T 13: 100,809,285 probably null Het
Snx17 G T 5: 31,196,551 probably null Het
Syt14 G T 1: 192,930,803 T563K probably damaging Het
Tada3 T C 6: 113,375,214 K85E probably damaging Het
Tspear T C 10: 77,881,087 V532A probably benign Het
Ttc30b A G 2: 75,936,711 V566A probably damaging Het
Ttn A T 2: 76,893,109 C6426S possibly damaging Het
Unc79 T C 12: 103,094,178 probably benign Het
Usp19 A G 9: 108,494,385 probably null Het
Vav3 G A 3: 109,527,430 D426N probably damaging Het
Vezt T C 10: 94,007,096 probably null Het
Vldlr G T 19: 27,236,255 R114L probably benign Het
Wdr34 A G 2: 30,031,825 V508A probably damaging Het
Wwc2 C T 8: 47,868,379 V567I unknown Het
Zfp423 T C 8: 87,780,609 T911A probably damaging Het
Zfp719 A G 7: 43,589,253 probably null Het
Zkscan16 A T 4: 58,956,597 H293L possibly damaging Het
Zkscan6 A C 11: 65,828,699 N515T possibly damaging Het
Znfx1 A G 2: 167,055,655 S450P probably damaging Het
Other mutations in Ppox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Ppox APN 1 171277880 critical splice donor site probably null
IGL01818:Ppox APN 1 171280744 missense probably benign 0.29
IGL01899:Ppox APN 1 171277082 missense probably benign 0.00
IGL01931:Ppox APN 1 171277883 missense probably null 0.51
IGL02802:Ppox UTSW 1 171277493 nonsense probably null
R0131:Ppox UTSW 1 171279275 missense possibly damaging 0.92
R0131:Ppox UTSW 1 171279275 missense possibly damaging 0.92
R0132:Ppox UTSW 1 171279275 missense possibly damaging 0.92
R0184:Ppox UTSW 1 171279552 missense probably damaging 1.00
R0426:Ppox UTSW 1 171277749 missense probably damaging 1.00
R0615:Ppox UTSW 1 171277814 splice site probably benign
R1559:Ppox UTSW 1 171280006 intron probably benign
R3687:Ppox UTSW 1 171277493 missense probably damaging 1.00
R4941:Ppox UTSW 1 171277593 missense probably damaging 0.99
R5037:Ppox UTSW 1 171277596 missense probably damaging 1.00
R5599:Ppox UTSW 1 171277460 missense probably damaging 1.00
R5739:Ppox UTSW 1 171279996 missense probably damaging 1.00
R5791:Ppox UTSW 1 171277312 missense probably damaging 1.00
R5892:Ppox UTSW 1 171277461 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACGTAGGTTCGCTACACTCCAG -3'
(R):5'- AGTCTCTCACAAGCAGGGCCAATG -3'

Sequencing Primer
(F):5'- CGCTACACTCCAGAGGTTC -3'
(R):5'- TCCTTTTAGGACAGAGTCCCCA -3'
Posted On2013-06-12