Incidental Mutation 'R0542:Znfx1'
ID49965
Institutional Source Beutler Lab
Gene Symbol Znfx1
Ensembl Gene ENSMUSG00000039501
Gene Namezinc finger, NFX1-type containing 1
Synonyms
MMRRC Submission 038734-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0542 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167035793-167063015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 167055655 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 450 (S450P)
Ref Sequence ENSEMBL: ENSMUSP00000121750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048988] [ENSMUST00000128676] [ENSMUST00000155281]
Predicted Effect probably damaging
Transcript: ENSMUST00000048988
AA Change: S450P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049404
Gene: ENSMUSG00000039501
AA Change: S450P

DomainStartEndE-ValueType
Pfam:AAA_11 590 855 2.2e-17 PFAM
Pfam:AAA_19 597 684 1.7e-10 PFAM
Pfam:AAA_11 829 1033 1.4e-18 PFAM
Pfam:AAA_12 1044 1228 3.7e-42 PFAM
internal_repeat_2 1281 1374 1.33e-7 PROSPERO
internal_repeat_1 1292 1410 1.32e-16 PROSPERO
low complexity region 1422 1433 N/A INTRINSIC
internal_repeat_1 1434 1547 1.32e-16 PROSPERO
internal_repeat_2 1453 1555 1.33e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000128676
AA Change: S450P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121598
Gene: ENSMUSG00000039501
AA Change: S450P

DomainStartEndE-ValueType
Pfam:AAA_11 590 837 1.8e-17 PFAM
Pfam:AAA_19 597 684 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135967
Predicted Effect probably damaging
Transcript: ENSMUST00000155281
AA Change: S450P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121750
Gene: ENSMUSG00000039501
AA Change: S450P

DomainStartEndE-ValueType
Pfam:AAA_11 590 854 1.7e-17 PFAM
Pfam:AAA_19 597 684 3.6e-11 PFAM
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,782,172 N22S probably benign Het
Abhd12b C A 12: 70,163,495 N71K possibly damaging Het
Adgrl2 A G 3: 148,859,218 I242T probably damaging Het
Adgrv1 A G 13: 81,573,318 S714P probably damaging Het
Agap3 G A 5: 24,500,186 R704Q possibly damaging Het
Ankrd11 T C 8: 122,895,770 R448G probably damaging Het
Anks1b T C 10: 90,073,967 probably benign Het
Caml A T 13: 55,623,161 Q24L possibly damaging Het
Cdc14b G A 13: 64,243,683 T124I probably benign Het
Clca2 A G 3: 145,075,810 probably benign Het
Col12a1 A G 9: 79,605,328 probably null Het
Crispld1 T C 1: 17,746,768 V183A possibly damaging Het
Dhx40 C T 11: 86,804,256 probably null Het
Dmxl1 T A 18: 49,893,694 D1956E probably benign Het
Dsc2 A G 18: 20,051,226 V35A probably damaging Het
Dusp27 A T 1: 166,101,284 M253K possibly damaging Het
Elovl2 A G 13: 41,191,976 probably benign Het
Gapvd1 T C 2: 34,725,036 probably benign Het
Gnaq T A 19: 16,219,618 I56N probably damaging Het
Gpr139 T C 7: 119,145,083 D93G probably benign Het
Hars C T 18: 36,771,181 R215H probably benign Het
Helz2 C A 2: 181,232,089 W2204L probably damaging Het
Itgb6 A T 2: 60,605,136 C757S possibly damaging Het
Kpnb1 G A 11: 97,187,572 T5I probably benign Het
Krt82 T C 15: 101,545,600 probably benign Het
Lgals9 T A 11: 78,969,720 K175N possibly damaging Het
Lrp2 A G 2: 69,428,654 I4564T probably benign Het
Mblac1 A G 5: 138,194,536 T47A possibly damaging Het
Med12l G A 3: 59,042,401 D182N probably damaging Het
Megf9 A G 4: 70,435,348 I407T probably benign Het
Mtmr6 A T 14: 60,292,129 probably null Het
Mtor A G 4: 148,540,450 T2173A probably benign Het
Mzt1 A T 14: 99,040,502 probably benign Het
Narf T C 11: 121,252,864 L444P probably damaging Het
Nsd1 A T 13: 55,260,458 Q1305L possibly damaging Het
Ntsr1 A G 2: 180,542,581 Y359C probably damaging Het
Olfm1 A G 2: 28,214,628 D159G possibly damaging Het
Olfr168 A T 16: 19,529,982 *313R probably null Het
Pcdh1 C T 18: 38,189,922 V953I probably damaging Het
Pcdhb11 A T 18: 37,423,834 D739V probably damaging Het
Pdgfd A G 9: 6,359,769 N280S probably damaging Het
Per2 A T 1: 91,438,332 probably null Het
Pfkp G T 13: 6,621,992 C122* probably null Het
Plxna4 G A 6: 32,192,297 R1322W probably damaging Het
Ppox A G 1: 171,279,244 L202P probably damaging Het
Ppp1r3e G A 14: 54,877,131 P58L probably benign Het
Prr23a2 A C 9: 98,857,033 N148T probably benign Het
Psd T C 19: 46,314,210 T842A probably damaging Het
Ranbp2 C T 10: 58,478,414 A1652V probably benign Het
Rragd G A 4: 33,007,103 V144M probably damaging Het
Sema6a T G 18: 47,248,576 D968A probably damaging Het
Slc30a5 A T 13: 100,809,285 probably null Het
Snx17 G T 5: 31,196,551 probably null Het
Syt14 G T 1: 192,930,803 T563K probably damaging Het
Tada3 T C 6: 113,375,214 K85E probably damaging Het
Tspear T C 10: 77,881,087 V532A probably benign Het
Ttc30b A G 2: 75,936,711 V566A probably damaging Het
Ttn A T 2: 76,893,109 C6426S possibly damaging Het
Unc79 T C 12: 103,094,178 probably benign Het
Usp19 A G 9: 108,494,385 probably null Het
Vav3 G A 3: 109,527,430 D426N probably damaging Het
Vezt T C 10: 94,007,096 probably null Het
Vldlr G T 19: 27,236,255 R114L probably benign Het
Wdr34 A G 2: 30,031,825 V508A probably damaging Het
Wwc2 C T 8: 47,868,379 V567I unknown Het
Zfp423 T C 8: 87,780,609 T911A probably damaging Het
Zfp719 A G 7: 43,589,253 probably null Het
Zkscan16 A T 4: 58,956,597 H293L possibly damaging Het
Zkscan6 A C 11: 65,828,699 N515T possibly damaging Het
Other mutations in Znfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Znfx1 APN 2 167036729 missense possibly damaging 0.65
IGL00492:Znfx1 APN 2 167036923 missense probably damaging 1.00
IGL01285:Znfx1 APN 2 167038695 missense possibly damaging 0.76
IGL01343:Znfx1 APN 2 167037363 missense probably benign 0.16
IGL01767:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL01983:Znfx1 APN 2 167056350 missense probably damaging 1.00
IGL02006:Znfx1 APN 2 167055763 missense probably damaging 1.00
IGL02254:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL02421:Znfx1 APN 2 167060080 missense probably damaging 0.97
IGL02496:Znfx1 APN 2 167047630 missense possibly damaging 0.83
IGL02525:Znfx1 APN 2 167037537 missense probably benign 0.00
IGL02528:Znfx1 APN 2 167050404 missense probably benign 0.11
IGL02537:Znfx1 APN 2 167056167 missense probably benign 0.37
IGL03065:Znfx1 APN 2 167055765 missense probably benign 0.00
R0127:Znfx1 UTSW 2 167044210 missense possibly damaging 0.84
R0331:Znfx1 UTSW 2 167046978 missense probably benign 0.11
R0488:Znfx1 UTSW 2 167042563 missense possibly damaging 0.52
R0497:Znfx1 UTSW 2 167055411 missense probably benign 0.03
R0537:Znfx1 UTSW 2 167041701 missense probably damaging 1.00
R0650:Znfx1 UTSW 2 167047654 nonsense probably null
R0655:Znfx1 UTSW 2 167056907 missense probably damaging 1.00
R1104:Znfx1 UTSW 2 167055640 nonsense probably null
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1512:Znfx1 UTSW 2 167056317 missense probably benign 0.03
R1533:Znfx1 UTSW 2 167056788 missense probably benign 0.10
R1541:Znfx1 UTSW 2 167056190 missense probably damaging 0.99
R1642:Znfx1 UTSW 2 167039010 missense possibly damaging 0.95
R1720:Znfx1 UTSW 2 167044066 nonsense probably null
R1760:Znfx1 UTSW 2 167039866 missense probably damaging 0.96
R1865:Znfx1 UTSW 2 167038809 missense probably damaging 1.00
R1959:Znfx1 UTSW 2 167050350 missense probably damaging 1.00
R2088:Znfx1 UTSW 2 167055810 missense probably damaging 1.00
R4581:Znfx1 UTSW 2 167050316 missense probably damaging 1.00
R4622:Znfx1 UTSW 2 167041753 missense possibly damaging 0.91
R4649:Znfx1 UTSW 2 167056356 missense probably benign 0.08
R4685:Znfx1 UTSW 2 167039030 missense probably damaging 1.00
R4798:Znfx1 UTSW 2 167038569 unclassified probably null
R4827:Znfx1 UTSW 2 167044231 missense possibly damaging 0.77
R4870:Znfx1 UTSW 2 167055269 missense probably benign
R4910:Znfx1 UTSW 2 167036804 missense probably damaging 1.00
R4910:Znfx1 UTSW 2 167037482 missense probably benign 0.00
R5022:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5023:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5057:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5061:Znfx1 UTSW 2 167065398 unclassified probably benign
R5119:Znfx1 UTSW 2 167065387 unclassified probably benign
R5125:Znfx1 UTSW 2 167046939 missense possibly damaging 0.81
R5896:Znfx1 UTSW 2 167039000 missense probably damaging 1.00
R6107:Znfx1 UTSW 2 167037081 missense possibly damaging 0.67
R6112:Znfx1 UTSW 2 167038206 missense probably benign
R6158:Znfx1 UTSW 2 167056726 missense probably benign 0.19
R6281:Znfx1 UTSW 2 167055885 missense probably damaging 1.00
R6464:Znfx1 UTSW 2 167046922 missense probably benign 0.34
R6749:Znfx1 UTSW 2 167056599 missense probably benign 0.00
R6888:Znfx1 UTSW 2 167038940 missense possibly damaging 0.91
R6973:Znfx1 UTSW 2 167056761 missense probably benign 0.18
R7017:Znfx1 UTSW 2 167048534 missense probably damaging 1.00
R7138:Znfx1 UTSW 2 167056777 missense probably benign 0.03
X0064:Znfx1 UTSW 2 167055256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTTGTCTCCACCATGAGGAAAG -3'
(R):5'- GGGAAATACGAGAGCACTGCTGTC -3'

Sequencing Primer
(F):5'- CTCCACCATGAGGAAAGAGTCAG -3'
(R):5'- GAGAGCACTGCTGTCTACCTC -3'
Posted On2013-06-12