Incidental Mutation 'R5273:Mdm4'
ID499955
Institutional Source Beutler Lab
Gene Symbol Mdm4
Ensembl Gene ENSMUSG00000054387
Gene Nametransformed mouse 3T3 cell double minute 4
Synonyms4933417N07Rik, Mdmx
MMRRC Submission 042862-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5273 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132959484-133030561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132994582 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 274 (T274M)
Ref Sequence ENSEMBL: ENSMUSP00000140609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067398] [ENSMUST00000067429] [ENSMUST00000185398] [ENSMUST00000186617] [ENSMUST00000188090] [ENSMUST00000191212]
Predicted Effect probably benign
Transcript: ENSMUST00000067398
AA Change: T275M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068661
Gene: ENSMUSG00000054387
AA Change: T275M

DomainStartEndE-ValueType
Pfam:SWIB 26 96 3.7e-10 PFAM
low complexity region 281 295 N/A INTRINSIC
ZnF_RBZ 302 326 1.65e-2 SMART
RING 437 477 7.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067429
AA Change: T274M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070411
Gene: ENSMUSG00000054387
AA Change: T274M

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185398
SMART Domains Protein: ENSMUSP00000140090
Gene: ENSMUSG00000054387

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186513
Predicted Effect probably benign
Transcript: ENSMUST00000186617
AA Change: T274M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140812
Gene: ENSMUSG00000054387
AA Change: T274M

DomainStartEndE-ValueType
Pfam:SWIB 26 101 9.9e-15 PFAM
low complexity region 280 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188090
AA Change: T274M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140609
Gene: ENSMUSG00000054387
AA Change: T274M

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190312
Predicted Effect probably benign
Transcript: ENSMUST00000191212
SMART Domains Protein: ENSMUSP00000140006
Gene: ENSMUSG00000054387

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.4e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of this gene or overexpression of the encoded protein has been linked to a range of human cancers. A pseudogene has been identified on the X chromosome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality, decreased cellular proliferation, and abnormal nervous system development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,341 S2603P probably damaging Het
2410089E03Rik T C 15: 8,262,938 S3012P unknown Het
Abcc4 T C 14: 118,594,821 N799S possibly damaging Het
Arhgap20 A G 9: 51,848,616 N589S probably damaging Het
Armc10 C T 5: 21,653,428 A157V possibly damaging Het
Atp2b2 A G 6: 113,759,232 L958P probably damaging Het
Bhmt2 G A 13: 93,666,578 A149V possibly damaging Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc7a CATCAGCTGATAT CAT 8: 129,061,609 probably null Het
Cntnap4 A G 8: 112,733,438 D141G probably damaging Het
Dis3 A G 14: 99,098,806 V88A probably benign Het
Dnajc21 A T 15: 10,454,807 C316S probably damaging Het
Dnhd1 A G 7: 105,714,482 T4084A probably damaging Het
Dock3 A C 9: 106,900,705 probably null Het
Eml5 T C 12: 98,790,688 H1894R probably damaging Het
Galc T C 12: 98,252,071 Y174C probably damaging Het
Gm4841 C T 18: 60,270,743 V93I probably benign Het
Gm7995 T C 14: 42,311,456 Y98H probably damaging Het
Gnrhr T A 5: 86,182,246 H305L possibly damaging Het
Gpr179 A T 11: 97,347,430 F323I probably damaging Het
Kdm6b G T 11: 69,404,201 P1080Q unknown Het
Man2a1 C T 17: 64,733,785 T126I probably damaging Het
Mug1 T A 6: 121,873,789 V748E probably damaging Het
Nav3 A T 10: 109,693,038 probably null Het
Olfr957 A G 9: 39,511,499 S74P possibly damaging Het
Olfr974 T C 9: 39,942,557 V99A probably benign Het
Pcdhb1 T C 18: 37,265,713 V239A probably benign Het
Ppic T A 18: 53,409,258 H126L probably damaging Het
Sdk1 T C 5: 141,998,828 F463L probably damaging Het
Shroom1 A G 11: 53,463,844 E197G possibly damaging Het
Slc22a14 A G 9: 119,170,638 S496P probably benign Het
Slc27a1 G A 8: 71,584,256 G379S probably benign Het
Slco1a5 T C 6: 142,242,098 E505G probably benign Het
Snrpe A C 1: 133,609,780 probably benign Het
Sp100 G T 1: 85,709,104 V299F possibly damaging Het
Stard9 A G 2: 120,705,087 S3942G possibly damaging Het
Ttn A G 2: 76,814,604 V12969A probably damaging Het
Txndc11 T C 16: 11,128,623 Q108R probably benign Het
Wnk4 A T 11: 101,263,869 I295F probably damaging Het
Other mutations in Mdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Mdm4 APN 1 132994547 missense probably benign 0.02
IGL03034:Mdm4 APN 1 133011071 missense probably damaging 1.00
IGL03099:Mdm4 APN 1 132992209 missense probably damaging 1.00
Isla_nublar UTSW 1 133012692 missense probably damaging 1.00
Sun_island UTSW 1 133012651 missense probably damaging 1.00
R0630:Mdm4 UTSW 1 132991753 missense possibly damaging 0.47
R1170:Mdm4 UTSW 1 132991820 missense probably damaging 1.00
R1170:Mdm4 UTSW 1 133012692 missense probably damaging 1.00
R1774:Mdm4 UTSW 1 132996646 missense probably damaging 0.99
R1920:Mdm4 UTSW 1 133003800 missense probably benign 0.06
R2061:Mdm4 UTSW 1 133012651 missense probably damaging 1.00
R2212:Mdm4 UTSW 1 132994522 missense probably damaging 1.00
R3695:Mdm4 UTSW 1 132991993 missense probably benign 0.00
R3919:Mdm4 UTSW 1 132994568 missense possibly damaging 0.94
R5360:Mdm4 UTSW 1 132991658 makesense probably null
R6125:Mdm4 UTSW 1 132994510 missense possibly damaging 0.95
R6153:Mdm4 UTSW 1 132992107 missense probably damaging 1.00
R7028:Mdm4 UTSW 1 133003809 missense probably benign 0.09
R7234:Mdm4 UTSW 1 133011115 missense probably damaging 0.96
R7267:Mdm4 UTSW 1 132994573 missense probably benign 0.00
Z1088:Mdm4 UTSW 1 132994547 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTTGTGTTAGCAGGGACAG -3'
(R):5'- CGTGCACAACATAACATTTCCTG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- TGCACAACATAACATTTCCTGCATAG -3'
Posted On2017-11-30