Incidental Mutation 'R5753:Adamts6'
ID499959
Institutional Source Beutler Lab
Gene Symbol Adamts6
Ensembl Gene ENSMUSG00000046169
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6
Synonymsb2b2187.1Clo, b2b2182Clo, ADAM-TS6, b2b2029Clo, b2b1879.1Clo, b2b2228Clo, A930019D11Rik
MMRRC Submission 043358-MU
Accession Numbers

NCBI RefSeq: NM_001081020.1; MGI: 1347348

Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location104287835-104496695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104347350 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 359 (Y359C)
Ref Sequence ENSEMBL: ENSMUSP00000153665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065766] [ENSMUST00000223562] [ENSMUST00000224208] [ENSMUST00000224303] [ENSMUST00000224504] [ENSMUST00000224742] [ENSMUST00000224784]
Predicted Effect probably damaging
Transcript: ENSMUST00000065766
AA Change: Y359C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064570
Gene: ENSMUSG00000046169
AA Change: Y359C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 191 4.2e-40 PFAM
Pfam:Reprolysin_5 248 443 3.8e-17 PFAM
Pfam:Reprolysin_4 248 464 4.9e-12 PFAM
Pfam:Reprolysin 250 468 1.6e-27 PFAM
Pfam:Reprolysin_2 268 458 5.6e-15 PFAM
Pfam:Reprolysin_3 272 414 2.6e-14 PFAM
TSP1 561 613 3.98e-13 SMART
Pfam:ADAM_spacer1 717 829 2.9e-41 PFAM
TSP1 843 900 2.49e-5 SMART
TSP1 902 960 2.87e-5 SMART
TSP1 963 1018 1.36e-1 SMART
TSP1 1021 1069 2.36e-6 SMART
Pfam:PLAC 1083 1115 3.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223562
AA Change: Y359C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224208
AA Change: Y359C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224303
Predicted Effect probably benign
Transcript: ENSMUST00000224504
Predicted Effect probably benign
Transcript: ENSMUST00000224742
Predicted Effect probably damaging
Transcript: ENSMUST00000224784
AA Change: Y359C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Expression of this gene may be regulated by the cytokine TNF-alpha. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for induced mutations exhibit cardiovascular defects including double outlet right ventricle, ventricular septal defects and biventricular hypertrophy, and hydrops, thymus hypoplasia short snout and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Adamts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Adamts6 APN 13 104429790 missense possibly damaging 0.79
IGL00583:Adamts6 APN 13 104297218 nonsense probably null
IGL01305:Adamts6 APN 13 104390082 missense probably damaging 1.00
IGL01448:Adamts6 APN 13 104297164 missense probably damaging 1.00
IGL01517:Adamts6 APN 13 104390192 splice site probably benign
IGL01678:Adamts6 APN 13 104313688 missense probably damaging 1.00
IGL01737:Adamts6 APN 13 104390135 missense probably damaging 0.99
IGL02152:Adamts6 APN 13 104313660 missense probably null 1.00
IGL02217:Adamts6 APN 13 104462365 splice site probably benign
IGL02828:Adamts6 APN 13 104297470 missense probably damaging 1.00
IGL03067:Adamts6 APN 13 104297275 missense probably damaging 1.00
IGL03081:Adamts6 APN 13 104444956 utr 3 prime probably benign
IGL03159:Adamts6 APN 13 104444215 missense probably damaging 1.00
IGL03411:Adamts6 APN 13 104314334 missense possibly damaging 0.77
ANU22:Adamts6 UTSW 13 104390082 missense probably damaging 1.00
P0007:Adamts6 UTSW 13 104297491 missense possibly damaging 0.73
R0362:Adamts6 UTSW 13 104390076 critical splice acceptor site probably null
R0504:Adamts6 UTSW 13 104426930 splice site probably benign
R0549:Adamts6 UTSW 13 104297255 missense possibly damaging 0.60
R0566:Adamts6 UTSW 13 104444927 missense probably benign 0.00
R0703:Adamts6 UTSW 13 104352847 missense probably damaging 1.00
R0799:Adamts6 UTSW 13 104314271 missense probably damaging 1.00
R0838:Adamts6 UTSW 13 104413789 missense possibly damaging 0.47
R1500:Adamts6 UTSW 13 104312881 missense probably damaging 1.00
R1502:Adamts6 UTSW 13 104493637 missense probably damaging 1.00
R1547:Adamts6 UTSW 13 104444875 missense probably benign 0.26
R1619:Adamts6 UTSW 13 104312777 missense probably benign 0.14
R1727:Adamts6 UTSW 13 104428964 splice site probably benign
R1967:Adamts6 UTSW 13 104426951 nonsense probably null
R2013:Adamts6 UTSW 13 104314304 missense probably damaging 0.98
R2079:Adamts6 UTSW 13 104462238 missense probably benign 0.00
R2432:Adamts6 UTSW 13 104426977 missense probably benign 0.01
R3118:Adamts6 UTSW 13 104314279 missense possibly damaging 0.91
R4125:Adamts6 UTSW 13 104312904 missense probably damaging 1.00
R4274:Adamts6 UTSW 13 104314279 missense possibly damaging 0.91
R4795:Adamts6 UTSW 13 104444128 nonsense probably null
R4841:Adamts6 UTSW 13 104312787 missense probably benign 0.00
R4976:Adamts6 UTSW 13 104297490 missense probably damaging 0.98
R5085:Adamts6 UTSW 13 104307243 missense probably damaging 0.99
R5234:Adamts6 UTSW 13 104493622 missense probably damaging 1.00
R5403:Adamts6 UTSW 13 104352815 missense possibly damaging 0.86
R6027:Adamts6 UTSW 13 104479535 missense probably damaging 1.00
R6187:Adamts6 UTSW 13 104297425 missense probably damaging 1.00
R6229:Adamts6 UTSW 13 104347392 critical splice donor site probably null
R6243:Adamts6 UTSW 13 104314301 missense probably damaging 0.99
R6257:Adamts6 UTSW 13 104462282 missense probably benign
R6743:Adamts6 UTSW 13 104428928 missense probably damaging 1.00
R6775:Adamts6 UTSW 13 104313652 missense probably damaging 0.97
R7113:Adamts6 UTSW 13 104312759 missense probably benign
R7351:Adamts6 UTSW 13 104390112 missense possibly damaging 0.63
X0065:Adamts6 UTSW 13 104493628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTTGCATGCAGTCTG -3'
(R):5'- TCATACCATTTGCCAGGGAAC -3'

Sequencing Primer
(F):5'- AGTCTGCCTTTCTGCATGG -3'
(R):5'- GAAAGATCATGTCTCGTACATCAG -3'
Posted On2017-11-30