Incidental Mutation 'R5280:Atp9a'
ID499967
Institutional Source Beutler Lab
Gene Symbol Atp9a
Ensembl Gene ENSMUSG00000027546
Gene NameATPase, class II, type 9A
SynonymsClass II, IIa
MMRRC Submission 042840-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5280 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location168634438-168742409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 168639988 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 880 (Y880F)
Ref Sequence ENSEMBL: ENSMUSP00000136793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029060] [ENSMUST00000109175] [ENSMUST00000109176] [ENSMUST00000109177] [ENSMUST00000178504]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029060
AA Change: Y880F

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546
AA Change: Y880F

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109175
AA Change: Y864F

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546
AA Change: Y864F

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109176
AA Change: Y938F

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546
AA Change: Y938F

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109177
AA Change: Y862F

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546
AA Change: Y862F

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178504
AA Change: Y880F

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546
AA Change: Y880F

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200215
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 C T 17: 43,426,334 T218I probably damaging Het
Adgrv1 C A 13: 81,397,465 S5567I possibly damaging Het
Alpk1 T C 3: 127,681,164 T397A probably benign Het
Celsr1 T C 15: 85,930,546 T1905A probably benign Het
Chd8 G A 14: 52,205,125 A656V possibly damaging Het
Dffa A G 4: 149,117,934 N265S probably benign Het
Frrs1 A G 3: 116,880,896 D109G probably benign Het
Gm20821 A T Y: 9,783,963 K195M probably damaging Het
Ifi207 A T 1: 173,730,304 N289K unknown Het
Kank1 T C 19: 25,411,305 F781L probably benign Het
Lrba A T 3: 86,325,022 M759L possibly damaging Het
Lrp8 A G 4: 107,854,321 Y307C probably damaging Het
Neb T C 2: 52,147,156 H6847R probably damaging Het
Olfr599 T C 7: 103,338,501 V149A probably benign Het
Olfr703 G A 7: 106,844,695 C28Y probably benign Het
Pcdha5 C A 18: 36,961,702 Y421* probably null Het
Pclo T A 5: 14,540,717 D1010E unknown Het
Pld2 A T 11: 70,552,759 D449V probably damaging Het
Ppfia1 C A 7: 144,485,095 M1032I possibly damaging Het
Prickle2 C A 6: 92,376,210 L758F probably damaging Het
Sarm1 A G 11: 78,483,476 V564A probably damaging Het
Taf1b C A 12: 24,549,438 F398L probably benign Het
Tll2 A G 19: 41,117,257 I361T possibly damaging Het
Tmem260 T C 14: 48,505,259 V517A probably benign Het
Usp24 A G 4: 106,341,214 K106E probably benign Het
Vcan C A 13: 89,690,286 V2380F probably benign Het
Vmn2r65 A G 7: 84,946,334 S381P probably damaging Het
Vmn2r73 T C 7: 85,857,947 D719G probably damaging Het
Wdr5b T C 16: 36,041,832 V107A probably benign Het
Wdr7 G T 18: 63,987,312 V1475F probably benign Het
Ythdc2 A G 18: 44,860,621 D911G probably damaging Het
Zbtb32 T A 7: 30,590,204 E11V probably damaging Het
Zfp563 T G 17: 33,104,838 Y136D probably damaging Het
Other mutations in Atp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Atp9a APN 2 168640680 missense probably benign 0.24
IGL01594:Atp9a APN 2 168691012 missense probably damaging 1.00
IGL01911:Atp9a APN 2 168653561 missense probably damaging 1.00
IGL02606:Atp9a APN 2 168652668 missense probably damaging 1.00
IGL02639:Atp9a APN 2 168649620 missense probably damaging 1.00
IGL03011:Atp9a APN 2 168652632 missense probably damaging 1.00
IGL03294:Atp9a APN 2 168689305 missense probably benign 0.04
IGL03310:Atp9a APN 2 168639959 missense probably damaging 1.00
R0114:Atp9a UTSW 2 168710856 nonsense probably null
R0194:Atp9a UTSW 2 168643885 missense probably benign 0.00
R0427:Atp9a UTSW 2 168640697 critical splice acceptor site probably null
R0508:Atp9a UTSW 2 168649526 splice site probably null
R1611:Atp9a UTSW 2 168673569 missense probably damaging 1.00
R2120:Atp9a UTSW 2 168653537 missense probably damaging 1.00
R2330:Atp9a UTSW 2 168639929 missense probably benign 0.01
R2348:Atp9a UTSW 2 168710826 splice site probably benign
R2404:Atp9a UTSW 2 168675363 critical splice acceptor site probably null
R2881:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R2882:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R4029:Atp9a UTSW 2 168689325 missense probably damaging 1.00
R4371:Atp9a UTSW 2 168649615 missense probably damaging 1.00
R4411:Atp9a UTSW 2 168661933 missense probably damaging 1.00
R4446:Atp9a UTSW 2 168681997 missense possibly damaging 0.75
R4583:Atp9a UTSW 2 168689360 splice site probably null
R4626:Atp9a UTSW 2 168639943 missense probably damaging 1.00
R4661:Atp9a UTSW 2 168637672 missense possibly damaging 0.52
R4679:Atp9a UTSW 2 168661964 missense possibly damaging 0.95
R4738:Atp9a UTSW 2 168668181 missense probably benign
R5191:Atp9a UTSW 2 168662063 missense possibly damaging 0.51
R5216:Atp9a UTSW 2 168674888 missense probably benign 0.38
R5509:Atp9a UTSW 2 168639937 missense probably damaging 1.00
R5798:Atp9a UTSW 2 168690964 critical splice donor site probably null
R5807:Atp9a UTSW 2 168653534 missense probably damaging 0.98
R5926:Atp9a UTSW 2 168706271 missense probably damaging 1.00
R6046:Atp9a UTSW 2 168634870 missense probably benign 0.42
R6244:Atp9a UTSW 2 168689352 critical splice acceptor site probably null
R6307:Atp9a UTSW 2 168668170 missense probably benign 0.02
R6345:Atp9a UTSW 2 168676173 missense probably damaging 0.99
R6442:Atp9a UTSW 2 168649561 missense probably benign 0.01
R6459:Atp9a UTSW 2 168668013 missense probably damaging 1.00
R6769:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6771:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6841:Atp9a UTSW 2 168654220 missense possibly damaging 0.87
R7271:Atp9a UTSW 2 168734127
R7422:Atp9a UTSW 2 168648593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGCACTGGTCATTCCTG -3'
(R):5'- TGGCACTGTTATAATACACACAGC -3'

Sequencing Primer
(F):5'- GCACTGGTCATTCCTGCATAAC -3'
(R):5'- CAGCTCTCCTGTTTAGTAACATAGAG -3'
Posted On2017-11-30