Incidental Mutation 'R4577:Mef2a'
ID499987
Institutional Source Beutler Lab
Gene Symbol Mef2a
Ensembl Gene ENSMUSG00000030557
Gene Namemyocyte enhancer factor 2A
SynonymsA430079H05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location67231163-67372858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67240439 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 131 (N131S)
Ref Sequence ENSEMBL: ENSMUSP00000146872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032776] [ENSMUST00000072460] [ENSMUST00000076325] [ENSMUST00000107476] [ENSMUST00000135493] [ENSMUST00000156690] [ENSMUST00000207715] [ENSMUST00000208512]
Predicted Effect probably benign
Transcript: ENSMUST00000032776
AA Change: N289S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032776
Gene: ENSMUSG00000030557
AA Change: N289S

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072460
SMART Domains Protein: ENSMUSP00000138645
Gene: ENSMUSG00000030557

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076325
AA Change: N289S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075664
Gene: ENSMUSG00000030557
AA Change: N289S

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107476
AA Change: N287S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103100
Gene: ENSMUSG00000030557
AA Change: N287S

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
low complexity region 410 429 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135493
AA Change: N295S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138566
Gene: ENSMUSG00000030557
AA Change: N295S

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156690
AA Change: N295S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117496
Gene: ENSMUSG00000030557
AA Change: N295S

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 152 1.3e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207715
AA Change: N131S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207794
Predicted Effect probably benign
Transcript: ENSMUST00000208512
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Inactivation of this gene results in cardiac sudden death. Mice dying in the early postnatal period exhibit ventricular dilation, while mice dying in adulthood show a reduced number of mitochondria in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gm13178 A C 4: 144,703,753 I222S probably damaging Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Mef2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01923:Mef2a APN 7 67264872 missense probably damaging 0.98
IGL02112:Mef2a APN 7 67264872 missense probably damaging 0.98
P0024:Mef2a UTSW 7 67295574 missense probably damaging 1.00
R0390:Mef2a UTSW 7 67251724 missense probably damaging 0.96
R0583:Mef2a UTSW 7 67235148 nonsense probably null
R0584:Mef2a UTSW 7 67235148 nonsense probably null
R0589:Mef2a UTSW 7 67235148 nonsense probably null
R0597:Mef2a UTSW 7 67235148 nonsense probably null
R0608:Mef2a UTSW 7 67235148 nonsense probably null
R0704:Mef2a UTSW 7 67235148 nonsense probably null
R1859:Mef2a UTSW 7 67266018 missense probably damaging 0.97
R2166:Mef2a UTSW 7 67266122 missense probably damaging 1.00
R2427:Mef2a UTSW 7 67266060 missense probably damaging 0.98
R3618:Mef2a UTSW 7 67268327 missense probably benign 0.34
R3619:Mef2a UTSW 7 67268327 missense probably benign 0.34
R4576:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4578:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4635:Mef2a UTSW 7 67240427 missense possibly damaging 0.67
R5805:Mef2a UTSW 7 67251668 missense possibly damaging 0.89
X0011:Mef2a UTSW 7 67235164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTTGTTTAGAAAGCAGCAAG -3'
(R):5'- CATGCATCTGGGATTAATATGCTG -3'

Sequencing Primer
(F):5'- CCTTGTTTAGAAAGCAGCAAGAACAG -3'
(R):5'- GCATCTGGGATTAATATGCTGTAATC -3'
Posted On2017-11-30