Incidental Mutation 'R4582:Tmie'
ID500011
Institutional Source Beutler Lab
Gene Symbol Tmie
Ensembl Gene ENSMUSG00000049555
Gene Nametransmembrane inner ear
Synonyms5131400L21Rik, Mm.87012
MMRRC Submission 041803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4582 (G1)
Quality Score108
Status Not validated
Chromosome9
Chromosomal Location110865711-110880113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 110873797 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 32 (E32A)
Ref Sequence ENSEMBL: ENSMUSP00000060148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050958]
Predicted Effect probably benign
Transcript: ENSMUST00000050958
AA Change: E32A

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060148
Gene: ENSMUSG00000049555
AA Change: E32A

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 37 44 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199189
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane inner ear protein. Studies in mouse suggest that this gene is required for normal postnatal maturation of sensory hair cells in the cochlea, including correct development of stereocilia bundles. This gene is one of multiple genes responsible for recessive non-syndromic deafness (DFNB), also known as autosomal recessive nonsyndromic hearing loss (ARNSHL), the most common form of congenitally acquired inherited hearing impairment. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mutations in this gene cause circling behavior and deafness in homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra A T 15: 41,869,285 D128E probably benign Het
Akap11 A T 14: 78,511,929 V1006E possibly damaging Het
Ankrd7 T A 6: 18,868,021 N95K probably damaging Het
Brd9 T C 13: 73,947,733 F366L probably benign Het
Brinp2 A G 1: 158,267,938 F118L probably damaging Het
Ccdc138 T C 10: 58,507,643 probably null Het
Celsr3 T C 9: 108,845,723 F189L probably damaging Het
Cfap45 A G 1: 172,529,912 T36A probably benign Het
Clec4a1 G T 6: 122,932,191 V173L possibly damaging Het
Col6a5 G A 9: 105,862,764 T2552I probably benign Het
Dcaf15 A G 8: 84,097,969 V533A probably damaging Het
Dhrs9 A T 2: 69,397,653 I204F probably damaging Het
Dock7 A G 4: 99,003,916 V811A possibly damaging Het
Eef1akmt1 T C 14: 57,550,448 D151G probably damaging Het
Eif4g3 G A 4: 138,171,245 R1109H probably damaging Het
Gtpbp10 T C 5: 5,542,395 T191A possibly damaging Het
Hectd4 A G 5: 121,286,419 N714S possibly damaging Het
Lima1 T C 15: 99,780,992 T523A possibly damaging Het
Lipe A G 7: 25,397,702 L272P probably benign Het
Llgl2 A G 11: 115,850,706 E554G possibly damaging Het
Lrrc66 T C 5: 73,608,237 S488G possibly damaging Het
Man2a1 C T 17: 64,752,499 A1127V probably benign Het
Naglu A T 11: 101,071,929 I187F probably damaging Het
Nt5c1b T A 12: 10,390,054 M548K probably damaging Het
Olfr1338 A T 4: 118,753,893 I217N probably damaging Het
Olfr768 A T 10: 129,093,158 V272E possibly damaging Het
Pcdha3 T C 18: 36,947,432 V409A probably benign Het
Pde6b A T 5: 108,425,231 probably null Het
Pkd2 A T 5: 104,502,344 K857* probably null Het
Rfx4 T A 10: 84,844,300 S114T possibly damaging Het
Sacs G A 14: 61,191,698 G402D probably damaging Het
Slc22a5 C T 11: 53,891,209 E111K probably damaging Het
Sptbn1 G A 11: 30,219,597 R44C probably damaging Het
Taf1 T C X: 101,593,995 V1696A possibly damaging Het
Tm9sf3 C A 19: 41,256,166 G91C probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsga13 A T 6: 30,902,363 N138K probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a10 A T 1: 88,055,741 D87V possibly damaging Het
Vdac3-ps1 A T 13: 18,031,592 noncoding transcript Het
Vmn1r29 A C 6: 58,308,032 I246L probably damaging Het
Zbtb16 A G 9: 48,832,082 V310A probably benign Het
Other mutations in Tmie
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02363:Tmie APN 9 110870753 splice site probably benign
R4713:Tmie UTSW 9 110867528 missense probably damaging 0.99
R4900:Tmie UTSW 9 110866933 missense possibly damaging 0.69
R6850:Tmie UTSW 9 110866912 missense possibly damaging 0.68
R7142:Tmie UTSW 9 110870681 missense possibly damaging 0.95
R7202:Tmie UTSW 9 110867564 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAAGTCAGAGGCTGTGCTC -3'
(R):5'- AATGATGCGGACTCAACCTC -3'

Sequencing Primer
(F):5'- TCCGCCGTCAGACCAGTG -3'
(R):5'- AGCCAGAACTCTCCGCG -3'
Posted On2017-11-30