Incidental Mutation 'R4741:Doc2a'
ID500059
Institutional Source Beutler Lab
Gene Symbol Doc2a
Ensembl Gene ENSMUSG00000052301
Gene Namedouble C2, alpha
Synonyms
MMRRC Submission 042026-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R4741 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126847416-126852705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126851445 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 298 (T298S)
Ref Sequence ENSEMBL: ENSMUSP00000070119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050833] [ENSMUST00000064110] [ENSMUST00000106342] [ENSMUST00000106343] [ENSMUST00000137873] [ENSMUST00000139174] [ENSMUST00000141805] [ENSMUST00000147257] [ENSMUST00000152051] [ENSMUST00000205938] [ENSMUST00000206349] [ENSMUST00000206968]
Predicted Effect probably benign
Transcript: ENSMUST00000050833
SMART Domains Protein: ENSMUSP00000049851
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 86 108 N/A INTRINSIC
low complexity region 116 132 N/A INTRINSIC
low complexity region 163 171 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000064110
AA Change: T298S

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070119
Gene: ENSMUSG00000052301
AA Change: T298S

DomainStartEndE-ValueType
Blast:C2 8 37 2e-10 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
C2 110 215 1.68e-22 SMART
low complexity region 223 234 N/A INTRINSIC
C2 272 386 2.44e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106342
SMART Domains Protein: ENSMUSP00000101949
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
low complexity region 44 66 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 121 129 N/A INTRINSIC
low complexity region 142 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106343
SMART Domains Protein: ENSMUSP00000101950
Gene: ENSMUSG00000030689

DomainStartEndE-ValueType
coiled coil region 10 55 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 125 147 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 202 210 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125624
Predicted Effect probably benign
Transcript: ENSMUST00000137873
SMART Domains Protein: ENSMUSP00000119779
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 1e-11 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
C2 110 175 1.44e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139174
SMART Domains Protein: ENSMUSP00000117376
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 2e-12 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141805
SMART Domains Protein: ENSMUSP00000118143
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 5e-12 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
SCOP:d1rsy__ 81 134 1e-10 SMART
PDB:4MJJ|A 86 134 6e-26 PDB
Blast:C2 110 134 5e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147257
SMART Domains Protein: ENSMUSP00000123143
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 2e-12 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152051
SMART Domains Protein: ENSMUSP00000123483
Gene: ENSMUSG00000052301

DomainStartEndE-ValueType
Blast:C2 8 37 6e-11 BLAST
low complexity region 40 56 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
C2 110 215 1.68e-22 SMART
low complexity region 223 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154881
Predicted Effect probably benign
Transcript: ENSMUST00000176771
Predicted Effect probably benign
Transcript: ENSMUST00000205619
Predicted Effect probably benign
Transcript: ENSMUST00000205938
Predicted Effect probably benign
Transcript: ENSMUST00000205958
Predicted Effect probably benign
Transcript: ENSMUST00000206090
Predicted Effect probably benign
Transcript: ENSMUST00000206349
Predicted Effect probably benign
Transcript: ENSMUST00000206968
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two protein isoforms of the Double C2 protein, namely alpha (DOC2A) and beta (DOC2B), which contain two C2-like domains. DOC2A and DOC2B are encoded by different genes; these genes are at times confused with the unrelated DAB2 gene which was initially named DOC-2. DOC2A is mainly expressed in brain and is suggested to be involved in Ca(2+)-dependent neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous inactivation of this locus affects excitatory synaptic transmission, LTP, and learning/memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,942,375 T1079A probably damaging Het
Angptl2 T C 2: 33,246,188 Y462H probably benign Het
Arhgef12 A G 9: 42,972,153 I1360T possibly damaging Het
Armc10 T G 5: 21,651,836 L111R probably damaging Het
Atm T C 9: 53,453,607 K2628E probably benign Het
Best3 A T 10: 117,023,996 N387I probably benign Het
Brpf3 T C 17: 28,817,784 F721S possibly damaging Het
Cacna1c A G 6: 118,613,310 S1411P probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip2 T A 5: 134,516,269 T344S probably benign Het
Csmd1 A C 8: 15,910,447 W3323G probably damaging Het
Dpp9 T C 17: 56,205,286 N234S probably benign Het
Dtx2 C T 5: 136,026,517 R353C probably benign Het
Epm2aip1 A G 9: 111,272,613 H218R probably benign Het
F2rl1 G A 13: 95,514,143 T77M probably damaging Het
Fsd2 A G 7: 81,551,895 probably null Het
Grin2a T C 16: 9,663,512 Y475C probably damaging Het
H2-Ob T A 17: 34,242,571 S95T possibly damaging Het
Hddc3 A G 7: 80,345,716 T160A probably benign Het
Hp A T 8: 109,575,472 C281* probably null Het
Ighg1 T C 12: 113,326,558 probably benign Het
Ints7 A G 1: 191,619,635 I819V probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Jmjd1c A G 10: 67,224,939 I737V possibly damaging Het
Krt74 C T 15: 101,761,441 noncoding transcript Het
Lnpep T C 17: 17,571,658 Y407C probably damaging Het
Lrp4 T G 2: 91,511,567 C1842G probably damaging Het
Mug2 T A 6: 122,079,613 N1172K probably benign Het
Npy6r A T 18: 44,275,724 T71S probably damaging Het
Nsd3 A T 8: 25,673,366 I591F probably damaging Het
Oog2 A C 4: 144,195,145 E208D possibly damaging Het
Otogl A G 10: 107,779,260 I1928T probably benign Het
Papss1 T C 3: 131,619,099 L418P probably damaging Het
Pcdhb13 T A 18: 37,443,518 D316E probably benign Het
Pcdhgb2 T A 18: 37,691,684 probably null Het
Ptcd3 T A 6: 71,902,949 L108F probably damaging Het
Ralgps1 T C 2: 33,336,587 S31G probably benign Het
Rnf225 A T 7: 12,927,930 H12L probably benign Het
Ryr3 T A 2: 112,803,268 M2047L probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb3b G T 1: 107,154,470 Q355K probably benign Het
Slc8a2 T A 7: 16,134,308 F155Y probably damaging Het
Taf1c A G 8: 119,603,395 probably benign Het
Tln2 A G 9: 67,386,555 probably null Het
Tmpo A G 10: 91,162,644 V427A probably benign Het
Vmn1r17 A T 6: 57,361,352 Y9* probably null Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfand5 C T 19: 21,276,481 T16I probably damaging Het
Zfp352 A T 4: 90,224,940 K439M possibly damaging Het
Zfp786 G A 6: 47,820,691 H438Y probably damaging Het
Zfp808 T A 13: 62,171,949 C331S probably damaging Het
Other mutations in Doc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Doc2a APN 7 126851001 missense probably damaging 1.00
R0423:Doc2a UTSW 7 126848658 missense probably damaging 1.00
R0538:Doc2a UTSW 7 126848811 missense probably benign 0.15
R1922:Doc2a UTSW 7 126851431 missense probably damaging 1.00
R1992:Doc2a UTSW 7 126851807 critical splice donor site probably null
R2402:Doc2a UTSW 7 126848747 nonsense probably null
R4344:Doc2a UTSW 7 126851149 missense probably damaging 1.00
R4644:Doc2a UTSW 7 126851446 missense probably benign 0.02
R4932:Doc2a UTSW 7 126848580 unclassified probably benign
R5926:Doc2a UTSW 7 126849525 missense probably damaging 1.00
R6646:Doc2a UTSW 7 126851619 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCCTGTAGACTCACCTCTG -3'
(R):5'- TTCTGTGAGGCCTAACCACATC -3'

Sequencing Primer
(F):5'- GTAGACTCACCTCTGCCCCC -3'
(R):5'- GGCCTAACCACATCGCTGTC -3'
Posted On2017-11-30