Incidental Mutation 'R4757:Mccc1'
ID500063
Institutional Source Beutler Lab
Gene Symbol Mccc1
Ensembl Gene ENSMUSG00000027709
Gene Namemethylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
Synonyms2310058B18Rik, MCCA, MCCalpha, 1810045E08Rik
MMRRC Submission 041973-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4757 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location35959312-36000678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35995917 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 42 (G42E)
Ref Sequence ENSEMBL: ENSMUSP00000143266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029259] [ENSMUST00000199113] [ENSMUST00000200162]
Predicted Effect probably benign
Transcript: ENSMUST00000029259
AA Change: G42E

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029259
Gene: ENSMUSG00000027709
AA Change: G42E

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 4.7e-50 PFAM
Pfam:ATP-grasp_4 156 337 3.7e-20 PFAM
Pfam:RimK 158 358 1e-6 PFAM
Pfam:CPSase_L_D2 159 367 2.8e-79 PFAM
Pfam:ATP-grasp_3 160 339 8.1e-9 PFAM
Pfam:Dala_Dala_lig_C 165 335 1.2e-16 PFAM
Pfam:ATP-grasp 166 337 3.7e-13 PFAM
Biotin_carb_C 379 486 7.14e-48 SMART
Pfam:Biotin_lipoyl 644 710 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198515
Predicted Effect probably benign
Transcript: ENSMUST00000199113
AA Change: G42E

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143266
Gene: ENSMUSG00000027709
AA Change: G42E

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 3.5e-48 PFAM
Pfam:ATP-grasp_4 156 253 4.1e-10 PFAM
Pfam:CPSase_L_D2 159 253 1.2e-24 PFAM
Pfam:Dala_Dala_lig_C 165 254 1.6e-8 PFAM
Pfam:ATP-grasp 166 253 8.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200162
SMART Domains Protein: ENSMUSP00000143396
Gene: ENSMUSG00000027709

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Ankk1 T A 9: 49,415,930 M650L probably benign Het
Apod T A 16: 31,303,462 N65Y probably damaging Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Col4a4 A G 1: 82,528,466 F298L unknown Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Cyb5d1 T C 11: 69,394,988 D74G probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Duoxa2 G T 2: 122,300,591 V78L possibly damaging Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nedd4l A G 18: 65,165,605 S343G probably damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Olfr653 T C 7: 104,580,197 Y184H possibly damaging Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Phox2b A T 5: 67,098,854 Y30N probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Stxbp5l T C 16: 37,188,634 Y681C probably damaging Het
Sv2b T C 7: 75,124,170 T518A probably benign Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trp53bp2 A T 1: 182,458,774 M1060L probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Mccc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Mccc1 APN 3 35989860 missense probably damaging 0.99
IGL01601:Mccc1 APN 3 35989952 missense probably benign 0.00
IGL01671:Mccc1 APN 3 35964460 missense probably benign
IGL01784:Mccc1 APN 3 35976748 missense probably damaging 0.99
IGL01878:Mccc1 APN 3 35975892 missense probably damaging 1.00
IGL02088:Mccc1 APN 3 35974202 missense probably damaging 1.00
IGL02709:Mccc1 APN 3 35990739 makesense probably null
IGL02932:Mccc1 APN 3 35960029 missense possibly damaging 0.86
IGL02972:Mccc1 APN 3 35985089 missense possibly damaging 0.58
IGL03145:Mccc1 APN 3 35968446 missense probably benign
P0019:Mccc1 UTSW 3 35964395 missense probably benign 0.00
R0244:Mccc1 UTSW 3 35990047 critical splice donor site probably null
R0391:Mccc1 UTSW 3 35963570 splice site probably benign
R1466:Mccc1 UTSW 3 35974286 missense probably benign 0.01
R1466:Mccc1 UTSW 3 35974286 missense probably benign 0.01
R1591:Mccc1 UTSW 3 35989857 missense probably damaging 1.00
R1663:Mccc1 UTSW 3 35978933 missense probably damaging 1.00
R1827:Mccc1 UTSW 3 35985001 missense probably damaging 1.00
R3800:Mccc1 UTSW 3 36000509 missense probably damaging 1.00
R4290:Mccc1 UTSW 3 35990068 missense probably damaging 0.98
R4291:Mccc1 UTSW 3 35990068 missense probably damaging 0.98
R4707:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4783:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4785:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4798:Mccc1 UTSW 3 35985001 missense probably damaging 0.99
R4807:Mccc1 UTSW 3 35985046 missense probably damaging 1.00
R4915:Mccc1 UTSW 3 35997554 missense probably benign 0.00
R4917:Mccc1 UTSW 3 35997554 missense probably benign 0.00
R5010:Mccc1 UTSW 3 35979017 missense probably benign 0.15
R5106:Mccc1 UTSW 3 35972564 missense probably benign 0.22
R5168:Mccc1 UTSW 3 35990780 nonsense probably null
R5241:Mccc1 UTSW 3 35974196 missense probably benign 0.03
R5444:Mccc1 UTSW 3 35976742 missense probably benign 0.00
R5677:Mccc1 UTSW 3 35990048 critical splice donor site probably null
R5838:Mccc1 UTSW 3 35985082 missense possibly damaging 0.88
R5881:Mccc1 UTSW 3 35964382 missense probably benign 0.00
R6248:Mccc1 UTSW 3 35990164 missense probably damaging 1.00
R6381:Mccc1 UTSW 3 35976727 missense probably benign 0.13
R6564:Mccc1 UTSW 3 35976676 missense probably damaging 1.00
R6612:Mccc1 UTSW 3 35993930 missense probably benign 0.01
R6769:Mccc1 UTSW 3 35989843 critical splice donor site probably null
R6771:Mccc1 UTSW 3 35989843 critical splice donor site probably null
R7135:Mccc1 UTSW 3 35995818 missense probably damaging 1.00
R7236:Mccc1 UTSW 3 35983795 missense probably benign 0.13
R7274:Mccc1 UTSW 3 35989856 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGGAGCTGAACTGGACAC -3'
(R):5'- CTTGAGTTTGCGTTAACAGAGG -3'

Sequencing Primer
(F):5'- ACACACAGTCACTAACAAGATTTTG -3'
(R):5'- TGCGTTAACAGAGGTATTATGAAC -3'
Posted On2017-11-30