Incidental Mutation 'R4734:Tmem67'
ID500071
Institutional Source Beutler Lab
Gene Symbol Tmem67
Ensembl Gene ENSMUSG00000049488
Gene Nametransmembrane protein 67
Synonymsb2b1291.1Clo, 5330408M12Rik, b2b1163.1Clo
MMRRC Submission 041961-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4734 (G1)
Quality Score136
Status Not validated
Chromosome4
Chromosomal Location12039355-12090020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12063158 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 496 (D496G)
Ref Sequence ENSEMBL: ENSMUSP00000103928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050686] [ENSMUST00000108293]
Predicted Effect probably benign
Transcript: ENSMUST00000050686
AA Change: D430G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052644
Gene: ENSMUSG00000049488
AA Change: D430G

DomainStartEndE-ValueType
low complexity region 17 23 N/A INTRINSIC
Pfam:Meckelin 166 995 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108293
AA Change: D496G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103928
Gene: ENSMUSG00000049488
AA Change: D496G

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
Pfam:Meckelin 236 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131145
SMART Domains Protein: ENSMUSP00000115154
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146140
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the primary cilium and to the plasma membrane. The gene functions in centriole migration to the apical membrane and formation of the primary cilium. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal/postanal lethality, kidney cysts, and Meckel-Gruber or Joubert syndrome-like phenotypes depending on the filial generation of the backcross to C57BL/6J. Mice homozygous for an ENU-induced allele exhibit cardiovascular defects and cystic kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,417 M86K possibly damaging Het
2700062C07Rik A G 18: 24,470,904 M1V probably null Het
Abcb11 T A 2: 69,323,962 T87S possibly damaging Het
Arap3 A G 18: 37,996,275 V210A probably benign Het
Avl9 T C 6: 56,736,494 S246P probably damaging Het
Ccdc88a A G 11: 29,482,720 K222R probably benign Het
Chsy3 C A 18: 59,179,413 F319L probably benign Het
Coro2b T C 9: 62,426,578 T345A probably benign Het
Cpb1 A G 3: 20,263,712 V216A probably benign Het
Cyp2c65 A G 19: 39,072,334 I213V probably benign Het
Dcaf15 A G 8: 84,097,728 C586R probably benign Het
Ddr2 T A 1: 169,998,088 E314D probably benign Het
Dennd5a C T 7: 109,896,336 R1196H probably damaging Het
Dnah9 G A 11: 65,834,115 A4404V probably damaging Het
Dpf2 A G 19: 5,906,999 probably null Het
Eif2ak4 A T 2: 118,422,087 H302L probably damaging Het
Eif2d G T 1: 131,165,152 R399L probably damaging Het
Fat2 A G 11: 55,311,468 V260A probably benign Het
Fhod3 T A 18: 25,028,135 Y575N probably benign Het
Fscb T C 12: 64,474,470 E74G possibly damaging Het
Gdpd2 G A X: 100,734,193 M243I possibly damaging Het
Glra1 C A 11: 55,536,384 D42Y probably damaging Het
Gm281 T C 14: 13,845,292 N540S probably benign Het
Gm8882 T A 6: 132,361,928 N109I unknown Het
Gnl2 T C 4: 125,041,018 F156L probably benign Het
Gpr37 C A 6: 25,689,086 R4L possibly damaging Het
Hectd4 A T 5: 121,341,977 H2892L possibly damaging Het
Helb T C 10: 120,084,849 D1063G probably benign Het
Htr2c A G X: 147,193,797 T163A probably benign Het
Impact T A 18: 12,985,289 H188Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnx2 C T 5: 147,029,137 G391R probably damaging Het
Lrrc19 T C 4: 94,638,349 I324V probably benign Het
Lrrcc1 G T 3: 14,562,285 Q458H probably damaging Het
Maml3 A T 3: 51,689,875 D483E probably damaging Het
Mef2c T A 13: 83,662,629 *467R probably null Het
Mms19 T A 19: 41,944,558 S1031C probably damaging Het
Myt1l T C 12: 29,919,926 I143T possibly damaging Het
Nuggc T C 14: 65,623,230 Y426H probably damaging Het
Oit3 A T 10: 59,424,082 C500S probably damaging Het
Olfr464 T A 11: 87,914,190 T239S probably damaging Het
Olfr470 T C 7: 107,845,428 I102V probably benign Het
Olfr491 A T 7: 108,317,752 N286I probably damaging Het
Olfr566 A G 7: 102,856,979 I101T probably damaging Het
Oog2 T C 4: 144,196,451 S429P probably benign Het
Pcnt T C 10: 76,437,206 D93G probably benign Het
Pdia5 A T 16: 35,456,513 M95K probably benign Het
Pdzrn4 A T 15: 92,770,252 R762* probably null Het
Piezo1 G T 8: 122,498,206 Q654K probably damaging Het
Ppil3 A G 1: 58,431,269 Y141H probably benign Het
Rassf8 G T 6: 145,815,540 K197N probably benign Het
Ryr2 T C 13: 11,737,753 Q1894R probably damaging Het
Ryr3 T A 2: 112,910,502 N487Y probably damaging Het
Scn5a T C 9: 119,539,538 Y307C probably damaging Het
Sdad1 C T 5: 92,304,977 R134Q possibly damaging Het
Shroom1 C T 11: 53,465,233 S370F probably damaging Het
Slc29a3 A G 10: 60,716,326 V313A probably benign Het
Slc2a9 C A 5: 38,382,099 G353C probably damaging Het
Snx33 T A 9: 56,925,901 T295S possibly damaging Het
Spata31d1b G A 13: 59,718,358 V1107M probably damaging Het
Supt6 T C 11: 78,224,683 D761G probably benign Het
Tfeb T C 17: 47,785,862 V18A probably benign Het
Thap12 G T 7: 98,715,954 C443F probably damaging Het
Thap12 T A 7: 98,715,955 C443* probably null Het
Trappc8 G A 18: 20,841,572 R900* probably null Het
Trim9 T C 12: 70,248,273 N688D probably damaging Het
Trmt1l A T 1: 151,442,637 I80L probably benign Het
Trpm5 C A 7: 143,082,785 V472L probably benign Het
Tspear C T 10: 77,864,695 L120F probably damaging Het
Ttc9b G A 7: 27,656,018 V238M probably benign Het
Usp20 A G 2: 31,019,824 I819V probably benign Het
Vmn2r102 T A 17: 19,677,533 V270E probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zc3h18 A T 8: 122,383,643 D77V probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Other mutations in Tmem67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Tmem67 APN 4 12061826 missense probably damaging 0.98
IGL00768:Tmem67 APN 4 12055029 critical splice donor site probably null
IGL00813:Tmem67 APN 4 12058587 splice site probably benign
IGL01070:Tmem67 APN 4 12054750 missense probably benign 0.20
IGL01088:Tmem67 APN 4 12063126 missense probably damaging 1.00
IGL01353:Tmem67 APN 4 12079895 missense probably damaging 1.00
IGL01490:Tmem67 APN 4 12057422 splice site probably benign
IGL01885:Tmem67 APN 4 12057389 missense probably damaging 1.00
IGL02061:Tmem67 APN 4 12053526 missense probably damaging 1.00
IGL02151:Tmem67 APN 4 12068882 missense probably benign 0.35
IGL02166:Tmem67 APN 4 12047313 missense possibly damaging 0.90
IGL02243:Tmem67 APN 4 12070584 missense possibly damaging 0.93
IGL02517:Tmem67 APN 4 12069463 missense possibly damaging 0.67
IGL02736:Tmem67 APN 4 12045789 splice site probably null
R0282:Tmem67 UTSW 4 12087930 missense probably damaging 0.99
R0514:Tmem67 UTSW 4 12089317 missense probably benign
R1221:Tmem67 UTSW 4 12045871 missense possibly damaging 0.92
R1301:Tmem67 UTSW 4 12089400 unclassified probably benign
R1581:Tmem67 UTSW 4 12047814 missense probably damaging 1.00
R1680:Tmem67 UTSW 4 12087840 missense probably benign 0.00
R1804:Tmem67 UTSW 4 12045789 splice site probably null
R2174:Tmem67 UTSW 4 12063730 nonsense probably null
R2191:Tmem67 UTSW 4 12069413 critical splice donor site probably null
R2246:Tmem67 UTSW 4 12040651 missense probably damaging 1.00
R2566:Tmem67 UTSW 4 12079918 missense probably damaging 0.99
R3409:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R3410:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R4078:Tmem67 UTSW 4 12040633 critical splice donor site probably null
R4282:Tmem67 UTSW 4 12073922 missense probably damaging 0.99
R4429:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4430:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4431:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4856:Tmem67 UTSW 4 12089416 unclassified probably benign
R4865:Tmem67 UTSW 4 12070262 missense probably benign 0.01
R5056:Tmem67 UTSW 4 12070471 missense probably benign 0.29
R5575:Tmem67 UTSW 4 12047886 missense possibly damaging 0.93
R5614:Tmem67 UTSW 4 12061755 missense possibly damaging 0.54
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6182:Tmem67 UTSW 4 12051402 missense probably benign 0.05
R6562:Tmem67 UTSW 4 12053445 critical splice donor site probably null
R6574:Tmem67 UTSW 4 12063086 missense possibly damaging 0.70
R6696:Tmem67 UTSW 4 12061754 critical splice donor site probably null
R6824:Tmem67 UTSW 4 12051449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCGGTTCTACCTATTGC -3'
(R):5'- TGGCTGACAATTTCCTACAGGAG -3'

Sequencing Primer
(F):5'- CCTATTGCTTCAGTCTGATAACAAC -3'
(R):5'- TCCTACAGGAGTAGCCCTTAGTG -3'
Posted On2017-11-30