Incidental Mutation 'R5754:Nrap'
ID500084
Institutional Source Beutler Lab
Gene Symbol Nrap
Ensembl Gene ENSMUSG00000049134
Gene Namenebulin-related anchoring protein
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5754 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56320035-56390037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56389484 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 25 (T25A)
Ref Sequence ENSEMBL: ENSMUSP00000132582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040711] [ENSMUST00000073536] [ENSMUST00000095947] [ENSMUST00000166203] [ENSMUST00000167239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040711
AA Change: T25A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048364
Gene: ENSMUSG00000049134
AA Change: T25A

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 1.76e-2 SMART
NEBU 1418 1448 2.09e0 SMART
NEBU 1453 1483 6.4e-5 SMART
NEBU 1489 1519 8.63e-1 SMART
NEBU 1527 1557 1.33e-2 SMART
NEBU 1562 1592 1.84e-5 SMART
NEBU 1593 1623 7.24e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073536
AA Change: T25A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073228
Gene: ENSMUSG00000049134
AA Change: T25A

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.73e-10 SMART
NEBU 556 586 8.12e-7 SMART
NEBU 590 620 1.73e-1 SMART
NEBU 625 655 2.33e-7 SMART
NEBU 656 686 1.49e-5 SMART
NEBU 690 721 5.12e-4 SMART
NEBU 724 754 8.12e-7 SMART
NEBU 759 789 2.64e-6 SMART
NEBU 795 825 3.48e-6 SMART
NEBU 833 863 2.35e-3 SMART
NEBU 868 898 6.11e-2 SMART
NEBU 899 929 1.69e-4 SMART
NEBU 934 964 3.88e-4 SMART
NEBU 967 997 4e-6 SMART
NEBU 1002 1032 4.22e-5 SMART
NEBU 1038 1068 2.64e-6 SMART
NEBU 1076 1106 3.68e-5 SMART
NEBU 1111 1141 4.16e-4 SMART
NEBU 1142 1172 1.1e-3 SMART
NEBU 1177 1207 1.68e1 SMART
NEBU 1210 1240 4.59e-6 SMART
NEBU 1245 1275 4.06e-7 SMART
NEBU 1281 1311 1.99e-1 SMART
NEBU 1319 1349 1.85e-1 SMART
NEBU 1354 1384 1.39e-5 SMART
NEBU 1385 1415 4.03e-2 SMART
NEBU 1420 1450 1.76e-2 SMART
NEBU 1453 1483 2.09e0 SMART
NEBU 1488 1518 6.4e-5 SMART
NEBU 1524 1554 8.63e-1 SMART
NEBU 1562 1592 1.33e-2 SMART
NEBU 1597 1627 1.84e-5 SMART
NEBU 1628 1658 7.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095947
SMART Domains Protein: ENSMUSP00000093640
Gene: ENSMUSG00000049134

DomainStartEndE-ValueType
NEBU 86 115 1.2e-6 SMART
NEBU 120 150 9.1e-8 SMART
NEBU 157 186 1.4e-6 SMART
NEBU 226 255 1.8e-8 SMART
NEBU 264 294 2.5e-5 SMART
NEBU 300 330 7.8e-6 SMART
NEBU 368 398 6e-11 SMART
NEBU 403 433 1.1e-12 SMART
NEBU 439 469 5.2e-9 SMART
NEBU 473 503 1.1e-3 SMART
NEBU 508 538 1.5e-9 SMART
NEBU 539 569 1e-7 SMART
NEBU 573 604 3.3e-6 SMART
NEBU 607 637 5.4e-9 SMART
NEBU 642 672 1.7e-8 SMART
NEBU 678 708 2.3e-8 SMART
NEBU 716 746 1.5e-5 SMART
NEBU 751 781 4.1e-4 SMART
NEBU 782 812 1.1e-6 SMART
NEBU 817 847 2.6e-6 SMART
NEBU 850 880 2.6e-8 SMART
NEBU 885 915 2.7e-7 SMART
NEBU 921 951 1.7e-8 SMART
NEBU 959 989 2.4e-7 SMART
NEBU 994 1024 2.7e-6 SMART
NEBU 1025 1055 7.2e-6 SMART
NEBU 1060 1090 1.1e-1 SMART
NEBU 1093 1123 3e-8 SMART
NEBU 1128 1158 2.6e-9 SMART
NEBU 1164 1194 1.3e-3 SMART
NEBU 1202 1232 1.2e-3 SMART
NEBU 1237 1267 8.8e-8 SMART
NEBU 1268 1298 2.7e-4 SMART
NEBU 1303 1333 1.2e-4 SMART
NEBU 1336 1366 1.4e-2 SMART
NEBU 1371 1401 4.3e-7 SMART
NEBU 1407 1437 5.6e-3 SMART
NEBU 1445 1475 8.8e-5 SMART
NEBU 1480 1510 1.2e-7 SMART
NEBU 1511 1541 4.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166203
AA Change: T25A

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132582
Gene: ENSMUSG00000049134
AA Change: T25A

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 7.24e-4 SMART
NEBU 381 411 3.46e-1 SMART
NEBU 417 447 1.18e-3 SMART
NEBU 485 515 8.97e-9 SMART
NEBU 520 550 1.06e-10 SMART
NEBU 554 584 1.73e-1 SMART
NEBU 589 619 2.33e-7 SMART
NEBU 620 650 1.49e-5 SMART
NEBU 654 685 5.12e-4 SMART
NEBU 688 718 8.12e-7 SMART
NEBU 723 753 2.64e-6 SMART
NEBU 759 789 3.48e-6 SMART
NEBU 797 827 2.35e-3 SMART
NEBU 832 862 6.11e-2 SMART
NEBU 863 893 1.69e-4 SMART
NEBU 898 928 3.88e-4 SMART
NEBU 931 961 4e-6 SMART
NEBU 966 996 4.22e-5 SMART
NEBU 1002 1032 2.64e-6 SMART
NEBU 1040 1070 3.68e-5 SMART
NEBU 1075 1105 4.16e-4 SMART
NEBU 1106 1136 1.1e-3 SMART
NEBU 1141 1171 1.68e1 SMART
NEBU 1174 1204 4.59e-6 SMART
NEBU 1209 1239 4.06e-7 SMART
NEBU 1245 1275 1.99e-1 SMART
NEBU 1283 1313 1.85e-1 SMART
NEBU 1318 1348 1.39e-5 SMART
NEBU 1349 1379 4.03e-2 SMART
NEBU 1384 1414 1.76e-2 SMART
NEBU 1417 1447 2.09e0 SMART
NEBU 1452 1482 6.4e-5 SMART
NEBU 1488 1518 8.63e-1 SMART
NEBU 1526 1556 1.33e-2 SMART
NEBU 1561 1591 1.84e-5 SMART
NEBU 1592 1622 7.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167239
AA Change: T25A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128196
Gene: ENSMUSG00000049134
AA Change: T25A

DomainStartEndE-ValueType
LIM 5 57 5.39e-11 SMART
NEBU 64 94 2.17e1 SMART
NEBU 168 197 1.94e-4 SMART
NEBU 202 232 1.39e-5 SMART
NEBU 239 268 2.23e-4 SMART
NEBU 308 337 2.83e-6 SMART
NEBU 346 376 3.82e-3 SMART
NEBU 382 412 1.18e-3 SMART
NEBU 450 480 8.97e-9 SMART
NEBU 485 515 1.73e-10 SMART
NEBU 521 551 8.12e-7 SMART
NEBU 555 585 1.73e-1 SMART
NEBU 590 620 2.33e-7 SMART
NEBU 621 651 1.49e-5 SMART
NEBU 655 686 5.12e-4 SMART
NEBU 689 719 8.12e-7 SMART
NEBU 724 754 2.64e-6 SMART
NEBU 760 790 3.48e-6 SMART
NEBU 798 828 2.35e-3 SMART
NEBU 833 863 6.11e-2 SMART
NEBU 864 894 1.69e-4 SMART
NEBU 899 929 3.88e-4 SMART
NEBU 932 962 4e-6 SMART
NEBU 967 997 4.22e-5 SMART
NEBU 1003 1033 2.64e-6 SMART
NEBU 1041 1071 3.68e-5 SMART
NEBU 1076 1106 4.16e-4 SMART
NEBU 1107 1137 1.1e-3 SMART
NEBU 1142 1172 1.68e1 SMART
NEBU 1175 1205 4.59e-6 SMART
NEBU 1210 1240 4.06e-7 SMART
NEBU 1246 1276 1.99e-1 SMART
NEBU 1284 1314 1.85e-1 SMART
NEBU 1319 1349 1.39e-5 SMART
NEBU 1350 1380 4.03e-2 SMART
NEBU 1385 1415 3.06e-2 SMART
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,269,541 S609P probably damaging Het
Abcb4 T A 5: 8,934,320 N683K probably benign Het
Atad2b T A 12: 5,010,351 H915Q probably benign Het
Camk1d G T 2: 5,445,097 P91Q probably benign Het
Camk1d G C 2: 5,445,099 S90R probably damaging Het
Card11 T C 5: 140,899,769 E345G probably damaging Het
Ccdc58 A G 16: 36,085,057 N63S probably benign Het
Ccpg1 G T 9: 73,013,244 V714L possibly damaging Het
Chst9 T C 18: 15,453,197 E103G possibly damaging Het
Cnga1 C T 5: 72,605,272 V300I probably benign Het
Crb1 T C 1: 139,231,599 Y1295C probably damaging Het
Dnah5 A G 15: 28,401,868 T3392A probably benign Het
Elp3 C A 14: 65,547,990 R473L probably damaging Het
Epgn T A 5: 91,033,948 I145N probably benign Het
Fam107b G A 2: 3,778,420 G220D probably damaging Het
Fbn2 A G 18: 58,124,311 V328A probably benign Het
Fn1 A T 1: 71,600,322 I1770N probably damaging Het
Fndc1 T A 17: 7,769,753 Y1159F unknown Het
Frem2 A G 3: 53,537,258 L2484P probably damaging Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf3c1 A T 7: 125,644,065 V1789D possibly damaging Het
Hmgcl T C 4: 135,950,587 V33A probably damaging Het
Ighv7-1 A G 12: 113,896,619 F51S probably damaging Het
Kcna6 A G 6: 126,739,725 L67P probably damaging Het
Lamc1 A T 1: 153,247,284 V720E probably benign Het
Lrch1 T C 14: 74,817,118 D312G probably damaging Het
Nav2 A G 7: 49,557,046 T1540A probably damaging Het
Nisch A T 14: 31,191,416 probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Npc1l1 A G 11: 6,227,839 Y524H probably damaging Het
Nusap1 A G 2: 119,647,099 K363R probably damaging Het
Olfr1019 T C 2: 85,841,312 T160A probably damaging Het
Olfr1489 A G 19: 13,633,993 E294G probably damaging Het
Olfr873 T A 9: 20,301,094 L298Q probably damaging Het
Pde4d T C 13: 109,938,013 I384T probably damaging Het
Pkhd1 T A 1: 20,523,651 R1413* probably null Het
Plcd3 T A 11: 103,073,766 Y593F possibly damaging Het
Plxna1 A T 6: 89,333,105 I1026N possibly damaging Het
Podxl T A 6: 31,524,394 I409F probably damaging Het
Polq A C 16: 37,017,263 Q179P probably benign Het
Pomt1 T C 2: 32,247,590 V401A probably damaging Het
Qdpr C T 5: 45,439,385 G146S probably damaging Het
Shc4 T A 2: 125,670,298 Q2L probably damaging Het
Skint8 T A 4: 111,950,190 C358S probably benign Het
Smc5 T C 19: 23,244,103 E354G possibly damaging Het
Snx30 T C 4: 59,868,275 V129A probably damaging Het
Sp110 G C 1: 85,577,202 probably benign Het
Spag6 T A 2: 18,698,802 probably benign Het
Trim28 T A 7: 13,029,109 Y450N probably benign Het
Trip11 C T 12: 101,885,665 W428* probably null Het
Umodl1 T A 17: 30,994,787 V966E probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r72 T C 7: 11,669,849 Y224C probably damaging Het
Whrn A G 4: 63,416,588 S748P probably damaging Het
Zbtb41 T A 1: 139,432,078 probably null Het
Zfhx3 T C 8: 108,800,332 F954L probably damaging Het
Zfp456 A T 13: 67,366,240 I449K probably benign Het
Other mutations in Nrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Nrap APN 19 56372909 missense probably damaging 1.00
IGL00570:Nrap APN 19 56338113 missense probably benign 0.10
IGL00946:Nrap APN 19 56340626 splice site probably null
IGL01070:Nrap APN 19 56329084 missense probably damaging 1.00
IGL01111:Nrap APN 19 56345558 missense probably damaging 1.00
IGL01138:Nrap APN 19 56355538 missense probably damaging 1.00
IGL01290:Nrap APN 19 56361748 missense probably damaging 1.00
IGL01352:Nrap APN 19 56379836 missense probably benign 0.00
IGL01372:Nrap APN 19 56329102 critical splice acceptor site probably null
IGL01395:Nrap APN 19 56361793 missense probably damaging 1.00
IGL01413:Nrap APN 19 56389391 missense probably damaging 0.99
IGL01734:Nrap APN 19 56350309 missense probably damaging 1.00
IGL01933:Nrap APN 19 56388818 missense probably damaging 1.00
IGL02156:Nrap APN 19 56321000 missense probably damaging 1.00
IGL02415:Nrap APN 19 56382309 missense probably damaging 1.00
IGL02447:Nrap APN 19 56345519 nonsense probably null
IGL02864:Nrap APN 19 56350374 missense probably damaging 1.00
IGL02993:Nrap APN 19 56345533 missense probably damaging 1.00
IGL03003:Nrap APN 19 56321952 missense probably damaging 1.00
IGL03006:Nrap APN 19 56347164 missense probably benign 0.02
IGL03084:Nrap APN 19 56365454 missense probably damaging 1.00
IGL03136:Nrap APN 19 56342255 missense possibly damaging 0.69
IGL03272:Nrap APN 19 56345568 intron probably benign
IGL03389:Nrap APN 19 56351716 missense probably benign 0.10
R0116:Nrap UTSW 19 56355546 missense probably damaging 1.00
R0374:Nrap UTSW 19 56351622 missense probably damaging 1.00
R0715:Nrap UTSW 19 56357325 missense probably damaging 0.98
R0828:Nrap UTSW 19 56345558 missense probably damaging 1.00
R0883:Nrap UTSW 19 56345474 missense probably damaging 1.00
R1416:Nrap UTSW 19 56327293 missense possibly damaging 0.60
R1459:Nrap UTSW 19 56384130 missense probably benign 0.00
R1616:Nrap UTSW 19 56389823 missense probably damaging 1.00
R1676:Nrap UTSW 19 56335255 missense probably damaging 1.00
R1687:Nrap UTSW 19 56355529 missense probably damaging 0.99
R1766:Nrap UTSW 19 56335042 missense probably damaging 0.99
R1792:Nrap UTSW 19 56379158 missense probably benign 0.00
R1817:Nrap UTSW 19 56384055 unclassified probably benign
R1972:Nrap UTSW 19 56357353 missense probably damaging 1.00
R1982:Nrap UTSW 19 56384105 missense probably damaging 0.99
R2258:Nrap UTSW 19 56321962 missense possibly damaging 0.80
R2448:Nrap UTSW 19 56322030 missense possibly damaging 0.90
R3034:Nrap UTSW 19 56364005 missense probably damaging 1.00
R3801:Nrap UTSW 19 56321779 missense probably damaging 1.00
R3804:Nrap UTSW 19 56321779 missense probably damaging 1.00
R3923:Nrap UTSW 19 56380256 missense probably damaging 0.99
R3964:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3965:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3966:Nrap UTSW 19 56342144 missense probably damaging 1.00
R3980:Nrap UTSW 19 56381552 missense probably benign 0.01
R4182:Nrap UTSW 19 56350327 missense probably damaging 1.00
R4499:Nrap UTSW 19 56351481 missense probably damaging 0.97
R4573:Nrap UTSW 19 56342338 critical splice acceptor site probably null
R4603:Nrap UTSW 19 56335024 critical splice donor site probably null
R4689:Nrap UTSW 19 56386026 missense probably damaging 0.97
R4749:Nrap UTSW 19 56380237 missense probably damaging 0.96
R4845:Nrap UTSW 19 56351470 missense probably benign 0.16
R4937:Nrap UTSW 19 56347220 missense probably damaging 1.00
R4962:Nrap UTSW 19 56378143 missense probably damaging 1.00
R5156:Nrap UTSW 19 56371845 missense possibly damaging 0.94
R5181:Nrap UTSW 19 56345528 missense possibly damaging 0.85
R5202:Nrap UTSW 19 56335151 missense probably damaging 1.00
R5262:Nrap UTSW 19 56320223 missense possibly damaging 0.95
R5301:Nrap UTSW 19 56379109 missense probably damaging 1.00
R5380:Nrap UTSW 19 56381603 missense probably damaging 1.00
R5576:Nrap UTSW 19 56321982 missense probably damaging 0.99
R5631:Nrap UTSW 19 56354121 missense probably benign 0.19
R5799:Nrap UTSW 19 56342169 nonsense probably null
R5899:Nrap UTSW 19 56340574 missense possibly damaging 0.80
R5910:Nrap UTSW 19 56342311 missense probably benign 0.00
R5994:Nrap UTSW 19 56351599 nonsense probably null
R6124:Nrap UTSW 19 56386026 missense probably damaging 0.97
R6149:Nrap UTSW 19 56389453 missense possibly damaging 0.79
R6182:Nrap UTSW 19 56361698 missense probably benign
R6245:Nrap UTSW 19 56354221 missense probably damaging 1.00
R6245:Nrap UTSW 19 56379875 missense possibly damaging 0.80
R6270:Nrap UTSW 19 56320198 missense probably benign 0.00
R6274:Nrap UTSW 19 56361721 missense probably benign 0.21
R6340:Nrap UTSW 19 56347184 missense probably damaging 1.00
R6547:Nrap UTSW 19 56351566 missense probably benign 0.00
R6734:Nrap UTSW 19 56345509 missense probably damaging 0.99
R6770:Nrap UTSW 19 56382537 intron probably null
R6812:Nrap UTSW 19 56351676 missense probably damaging 1.00
R6843:Nrap UTSW 19 56380219 missense probably damaging 1.00
R7207:Nrap UTSW 19 56345521 missense probably damaging 1.00
R7214:Nrap UTSW 19 56378135 missense probably benign 0.09
R7313:Nrap UTSW 19 56342268 missense probably damaging 0.97
R7515:Nrap UTSW 19 56366427 missense possibly damaging 0.94
X0028:Nrap UTSW 19 56335220 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATATGAGTGTGCACCTCGGG -3'
(R):5'- CTTCTGCGCTGTTTCAAGGG -3'

Sequencing Primer
(F):5'- AGAGGTGCTACTCGGAGTC -3'
(R):5'- CCATGTGTAAGTTCAGGAACT -3'
Posted On2017-11-30