Incidental Mutation 'R0542:Olfr168'
ID50011
Institutional Source Beutler Lab
Gene Symbol Olfr168
Ensembl Gene ENSMUSG00000061361
Gene Nameolfactory receptor 168
SynonymsMOR271-1, GA_x54KRFPKG5P-15979009-15978071
MMRRC Submission 038734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0542 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19529274-19535555 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 19529982 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 313 (*313R)
Ref Sequence ENSEMBL: ENSMUSP00000149405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078554] [ENSMUST00000213480]
Predicted Effect probably null
Transcript: ENSMUST00000078554
AA Change: *313R
SMART Domains Protein: ENSMUSP00000077632
Gene: ENSMUSG00000061361
AA Change: *313R

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 5e-50 PFAM
Pfam:7TM_GPCR_Srsx 34 295 3.7e-8 PFAM
Pfam:7tm_1 40 289 3.6e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213480
AA Change: *313R
Meta Mutation Damage Score 0.6328 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,782,172 N22S probably benign Het
Abhd12b C A 12: 70,163,495 N71K possibly damaging Het
Adgrl2 A G 3: 148,859,218 I242T probably damaging Het
Adgrv1 A G 13: 81,573,318 S714P probably damaging Het
Agap3 G A 5: 24,500,186 R704Q possibly damaging Het
Ankrd11 T C 8: 122,895,770 R448G probably damaging Het
Anks1b T C 10: 90,073,967 probably benign Het
Caml A T 13: 55,623,161 Q24L possibly damaging Het
Cdc14b G A 13: 64,243,683 T124I probably benign Het
Clca2 A G 3: 145,075,810 probably benign Het
Col12a1 A G 9: 79,605,328 probably null Het
Crispld1 T C 1: 17,746,768 V183A possibly damaging Het
Dhx40 C T 11: 86,804,256 probably null Het
Dmxl1 T A 18: 49,893,694 D1956E probably benign Het
Dsc2 A G 18: 20,051,226 V35A probably damaging Het
Dusp27 A T 1: 166,101,284 M253K possibly damaging Het
Elovl2 A G 13: 41,191,976 probably benign Het
Gapvd1 T C 2: 34,725,036 probably benign Het
Gnaq T A 19: 16,219,618 I56N probably damaging Het
Gpr139 T C 7: 119,145,083 D93G probably benign Het
Hars C T 18: 36,771,181 R215H probably benign Het
Helz2 C A 2: 181,232,089 W2204L probably damaging Het
Itgb6 A T 2: 60,605,136 C757S possibly damaging Het
Kpnb1 G A 11: 97,187,572 T5I probably benign Het
Krt82 T C 15: 101,545,600 probably benign Het
Lgals9 T A 11: 78,969,720 K175N possibly damaging Het
Lrp2 A G 2: 69,428,654 I4564T probably benign Het
Mblac1 A G 5: 138,194,536 T47A possibly damaging Het
Med12l G A 3: 59,042,401 D182N probably damaging Het
Megf9 A G 4: 70,435,348 I407T probably benign Het
Mtmr6 A T 14: 60,292,129 probably null Het
Mtor A G 4: 148,540,450 T2173A probably benign Het
Mzt1 A T 14: 99,040,502 probably benign Het
Narf T C 11: 121,252,864 L444P probably damaging Het
Nsd1 A T 13: 55,260,458 Q1305L possibly damaging Het
Ntsr1 A G 2: 180,542,581 Y359C probably damaging Het
Olfm1 A G 2: 28,214,628 D159G possibly damaging Het
Pcdh1 C T 18: 38,189,922 V953I probably damaging Het
Pcdhb11 A T 18: 37,423,834 D739V probably damaging Het
Pdgfd A G 9: 6,359,769 N280S probably damaging Het
Per2 A T 1: 91,438,332 probably null Het
Pfkp G T 13: 6,621,992 C122* probably null Het
Plxna4 G A 6: 32,192,297 R1322W probably damaging Het
Ppox A G 1: 171,279,244 L202P probably damaging Het
Ppp1r3e G A 14: 54,877,131 P58L probably benign Het
Prr23a2 A C 9: 98,857,033 N148T probably benign Het
Psd T C 19: 46,314,210 T842A probably damaging Het
Ranbp2 C T 10: 58,478,414 A1652V probably benign Het
Rragd G A 4: 33,007,103 V144M probably damaging Het
Sema6a T G 18: 47,248,576 D968A probably damaging Het
Slc30a5 A T 13: 100,809,285 probably null Het
Snx17 G T 5: 31,196,551 probably null Het
Syt14 G T 1: 192,930,803 T563K probably damaging Het
Tada3 T C 6: 113,375,214 K85E probably damaging Het
Tspear T C 10: 77,881,087 V532A probably benign Het
Ttc30b A G 2: 75,936,711 V566A probably damaging Het
Ttn A T 2: 76,893,109 C6426S possibly damaging Het
Unc79 T C 12: 103,094,178 probably benign Het
Usp19 A G 9: 108,494,385 probably null Het
Vav3 G A 3: 109,527,430 D426N probably damaging Het
Vezt T C 10: 94,007,096 probably null Het
Vldlr G T 19: 27,236,255 R114L probably benign Het
Wdr34 A G 2: 30,031,825 V508A probably damaging Het
Wwc2 C T 8: 47,868,379 V567I unknown Het
Zfp423 T C 8: 87,780,609 T911A probably damaging Het
Zfp719 A G 7: 43,589,253 probably null Het
Zkscan16 A T 4: 58,956,597 H293L possibly damaging Het
Zkscan6 A C 11: 65,828,699 N515T possibly damaging Het
Znfx1 A G 2: 167,055,655 S450P probably damaging Het
Other mutations in Olfr168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Olfr168 APN 16 19530095 missense probably benign 0.13
IGL02139:Olfr168 APN 16 19530890 missense probably benign 0.05
IGL02347:Olfr168 APN 16 19530779 missense probably damaging 1.00
IGL03402:Olfr168 APN 16 19530917 start codon destroyed probably null 0.99
R1496:Olfr168 UTSW 16 19530383 missense possibly damaging 0.94
R1707:Olfr168 UTSW 16 19530177 missense probably benign 0.18
R2006:Olfr168 UTSW 16 19530705 missense probably benign 0.02
R2220:Olfr168 UTSW 16 19530145 nonsense probably null
R3734:Olfr168 UTSW 16 19530648 missense probably damaging 0.99
R4134:Olfr168 UTSW 16 19530702 missense possibly damaging 0.90
R4135:Olfr168 UTSW 16 19530702 missense possibly damaging 0.90
R4538:Olfr168 UTSW 16 19530631 nonsense probably null
R4631:Olfr168 UTSW 16 19530141 nonsense probably null
R4633:Olfr168 UTSW 16 19530284 missense possibly damaging 0.94
R4872:Olfr168 UTSW 16 19530633 missense probably damaging 0.99
R4910:Olfr168 UTSW 16 19530018 missense probably benign 0.03
R4945:Olfr168 UTSW 16 19530557 missense probably benign 0.03
R5345:Olfr168 UTSW 16 19530777 missense probably damaging 1.00
R5847:Olfr168 UTSW 16 19530326 missense probably damaging 0.99
R5899:Olfr168 UTSW 16 19530801 missense probably damaging 1.00
R7074:Olfr168 UTSW 16 19530105 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CATGTGTGGGCACAGTCCAAATTG -3'
(R):5'- TGTGAGCACAAGCCTGTTTCTCC -3'

Sequencing Primer
(F):5'- TGGGCACAGTCCAAATTGAATATG -3'
(R):5'- CAACTCACTTAACTGTGGTGAC -3'
Posted On2013-06-12