Incidental Mutation 'R1148:Disp2'
ID500207
Institutional Source Beutler Lab
Gene Symbol Disp2
Ensembl Gene ENSMUSG00000040035
Gene Namedispatched RND tramsporter family member 2
SynonymsB230210L08Rik, DispB
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R1148 (G1)
Quality Score200
Status Not validated
Chromosome2
Chromosomal Location118779719-118811293 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 118806418 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063975] [ENSMUST00000110846]
Predicted Effect probably benign
Transcript: ENSMUST00000063975
SMART Domains Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110846
SMART Domains Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Disp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Disp2 APN 2 118786278 missense probably damaging 1.00
IGL00970:Disp2 APN 2 118791793 missense probably damaging 1.00
IGL01790:Disp2 APN 2 118790880 missense probably damaging 1.00
IGL01809:Disp2 APN 2 118787264 splice site probably benign
IGL02069:Disp2 APN 2 118790680 missense possibly damaging 0.93
IGL02140:Disp2 APN 2 118790869 missense probably benign
IGL02143:Disp2 APN 2 118789969 missense probably damaging 1.00
IGL02155:Disp2 APN 2 118791804 missense probably damaging 1.00
IGL02884:Disp2 APN 2 118787551 splice site probably benign
IGL03113:Disp2 APN 2 118790778 unclassified probably null
IGL03194:Disp2 APN 2 118787629 missense probably damaging 1.00
PIT4453001:Disp2 UTSW 2 118787644 missense probably benign 0.01
R0109:Disp2 UTSW 2 118791816 missense probably damaging 1.00
R0126:Disp2 UTSW 2 118790338 missense probably damaging 1.00
R0603:Disp2 UTSW 2 118792006 missense probably damaging 1.00
R0610:Disp2 UTSW 2 118792236 missense probably benign 0.02
R0639:Disp2 UTSW 2 118790844 missense possibly damaging 0.74
R0673:Disp2 UTSW 2 118790844 missense possibly damaging 0.74
R0755:Disp2 UTSW 2 118789762 missense probably benign 0.00
R0781:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1110:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1148:Disp2 UTSW 2 118806418 critical splice donor site probably null
R1243:Disp2 UTSW 2 118791822 missense probably damaging 1.00
R1587:Disp2 UTSW 2 118791583 missense probably damaging 1.00
R1739:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R1771:Disp2 UTSW 2 118791297 nonsense probably null
R1781:Disp2 UTSW 2 118792561 missense probably damaging 0.96
R1918:Disp2 UTSW 2 118791927 missense probably benign
R1956:Disp2 UTSW 2 118792223 missense probably benign 0.02
R2167:Disp2 UTSW 2 118791685 missense probably damaging 1.00
R2206:Disp2 UTSW 2 118792244 missense probably benign 0.02
R4031:Disp2 UTSW 2 118791880 missense probably benign 0.27
R4617:Disp2 UTSW 2 118790162 missense probably benign
R4656:Disp2 UTSW 2 118790563 missense probably damaging 1.00
R4684:Disp2 UTSW 2 118792756 missense probably damaging 1.00
R4696:Disp2 UTSW 2 118791684 nonsense probably null
R4697:Disp2 UTSW 2 118791684 nonsense probably null
R4738:Disp2 UTSW 2 118790326 missense probably damaging 0.97
R4834:Disp2 UTSW 2 118792504 missense probably benign 0.09
R4914:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4915:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4918:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R5045:Disp2 UTSW 2 118792062 missense probably benign 0.03
R5208:Disp2 UTSW 2 118791805 missense probably damaging 1.00
R5303:Disp2 UTSW 2 118810848 unclassified probably benign
R5350:Disp2 UTSW 2 118787575 missense probably benign 0.23
R5355:Disp2 UTSW 2 118786911 missense probably benign 0.00
R6011:Disp2 UTSW 2 118790820 missense possibly damaging 0.65
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6139:Disp2 UTSW 2 118790662 missense probably damaging 0.97
R6169:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R6187:Disp2 UTSW 2 118792143 missense probably damaging 1.00
R6209:Disp2 UTSW 2 118786921 missense probably damaging 1.00
R6250:Disp2 UTSW 2 118790766 missense probably damaging 1.00
R6392:Disp2 UTSW 2 118790749 missense probably damaging 1.00
R7138:Disp2 UTSW 2 118786880 missense probably benign
Predicted Primers
Posted On2017-12-01