Incidental Mutation 'R1148:Ttc22'
ID500208
Institutional Source Beutler Lab
Gene Symbol Ttc22
Ensembl Gene ENSMUSG00000034919
Gene Nametetratricopeptide repeat domain 22
Synonyms
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R1148 (G1)
Quality Score143
Status Not validated
Chromosome4
Chromosomal Location106622432-106640189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106623031 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 161 (V161M)
Ref Sequence ENSEMBL: ENSMUSP00000035773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047922]
Predicted Effect probably damaging
Transcript: ENSMUST00000047922
AA Change: V161M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035773
Gene: ENSMUSG00000034919
AA Change: V161M

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
TPR 66 99 2.3e1 SMART
Pfam:TPR_8 100 128 2.5e-3 PFAM
TPR 295 328 2.99e1 SMART
TPR 432 465 6.19e-1 SMART
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 97.8%
  • 10x: 90.3%
  • 20x: 69.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with seven tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sgo2b A G 8: 63,926,855 L981P probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Other mutations in Ttc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Ttc22 APN 4 106638576 missense probably damaging 1.00
IGL01749:Ttc22 APN 4 106638603 missense probably benign 0.04
IGL02189:Ttc22 APN 4 106639157 missense probably benign 0.21
IGL02206:Ttc22 APN 4 106635989 missense probably damaging 1.00
IGL02219:Ttc22 APN 4 106638490 missense probably damaging 0.97
IGL02348:Ttc22 APN 4 106622938 missense probably damaging 1.00
IGL02754:Ttc22 APN 4 106638472 missense probably benign 0.22
IGL02982:Ttc22 APN 4 106638586 missense probably damaging 0.97
R0044:Ttc22 UTSW 4 106636806 missense probably benign
R0607:Ttc22 UTSW 4 106639313 missense possibly damaging 0.72
R0611:Ttc22 UTSW 4 106634184 missense probably damaging 1.00
R1148:Ttc22 UTSW 4 106623031 missense probably damaging 1.00
R1466:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1466:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1584:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1654:Ttc22 UTSW 4 106634211 missense probably damaging 1.00
R1776:Ttc22 UTSW 4 106639040 missense possibly damaging 0.64
R1864:Ttc22 UTSW 4 106636806 missense probably benign
R1886:Ttc22 UTSW 4 106636866 critical splice donor site probably null
R2136:Ttc22 UTSW 4 106622672 missense possibly damaging 0.49
R2156:Ttc22 UTSW 4 106639040 missense probably benign 0.43
R2267:Ttc22 UTSW 4 106639085 missense possibly damaging 0.60
R2698:Ttc22 UTSW 4 106639238 missense probably benign
R3162:Ttc22 UTSW 4 106623079 missense probably damaging 0.97
R3162:Ttc22 UTSW 4 106623079 missense probably damaging 0.97
R3754:Ttc22 UTSW 4 106639081 missense probably damaging 0.99
R5399:Ttc22 UTSW 4 106636757 missense probably damaging 1.00
R5839:Ttc22 UTSW 4 106638520 missense probably damaging 0.99
R6156:Ttc22 UTSW 4 106638583 missense probably benign 0.00
R6678:Ttc22 UTSW 4 106623045 missense probably benign 0.17
R6912:Ttc22 UTSW 4 106638603 missense probably benign 0.04
R7094:Ttc22 UTSW 4 106635907 nonsense probably null
Predicted Primers
Posted On2017-12-01