Incidental Mutation 'R1574:Cenpo'
ID500350
Institutional Source Beutler Lab
Gene Symbol Cenpo
Ensembl Gene ENSMUSG00000020652
Gene Namecentromere protein O
Synonyms2810429O05Rik, 8430427C03Rik, D12Ertd482e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R1574 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location4196004-4234294 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 4215433 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020981] [ENSMUST00000020984] [ENSMUST00000111169] [ENSMUST00000124505] [ENSMUST00000127756] [ENSMUST00000128466] [ENSMUST00000140975] [ENSMUST00000152065]
Predicted Effect probably null
Transcript: ENSMUST00000020981
SMART Domains Protein: ENSMUSP00000020981
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
Pfam:CENP-O 1 74 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020984
SMART Domains Protein: ENSMUSP00000020984
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111169
SMART Domains Protein: ENSMUSP00000106799
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 118 195 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124505
SMART Domains Protein: ENSMUSP00000122073
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126017
Predicted Effect probably benign
Transcript: ENSMUST00000127756
SMART Domains Protein: ENSMUSP00000115406
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128466
SMART Domains Protein: ENSMUSP00000121258
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 40 75 N/A INTRINSIC
Pfam:CENP-O 119 196 7.1e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140975
SMART Domains Protein: ENSMUSP00000119136
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 117 231 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146523
Predicted Effect probably benign
Transcript: ENSMUST00000152065
SMART Domains Protein: ENSMUSP00000115644
Gene: ENSMUSG00000020654

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152792
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 96.3%
  • 10x: 84.0%
  • 20x: 52.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the interphase centromere complex. The encoded protein is localized to the centromere throughout the cell cycle and is required for bipolar spindle assembly, chromosome segregation and checkpoint signaling during mitosis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Ankrd12 A T 17: 65,986,274 D721E probably benign Het
Anpep A G 7: 79,838,407 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
D430041D05Rik GTGATGATGATGATGATGATG GTGATGATGATGATGATG 2: 104,221,208 probably benign Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah2 A G 11: 69,514,688 V666A probably benign Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Fndc3a A T 14: 72,556,557 I892N probably damaging Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kcng1 T A 2: 168,269,041 N68Y probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Mtus2 A C 5: 148,076,552 K52Q probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Naca G T 10: 128,040,398 probably benign Het
Ncoa7 T C 10: 30,694,101 I249M probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1341 T A 4: 118,709,554 I49N probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Pkd1l3 A G 8: 109,614,813 I99M unknown Het
Ruvbl1 T C 6: 88,479,154 V70A probably damaging Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Srsf4 T A 4: 131,897,695 D134E probably damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tdrd6 G A 17: 43,625,624 S1511L probably damaging Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn1r42 C T 6: 89,845,381 G69S probably damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Zfp949 A T 9: 88,569,777 K467* probably null Het
Other mutations in Cenpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Cenpo APN 12 4216685 missense probably benign 0.02
IGL01661:Cenpo APN 12 4234023 unclassified probably null
IGL02716:Cenpo APN 12 4215390 missense possibly damaging 0.90
R0305:Cenpo UTSW 12 4216660 missense possibly damaging 0.48
R0811:Cenpo UTSW 12 4216643 missense probably benign 0.06
R0812:Cenpo UTSW 12 4216643 missense probably benign 0.06
R1574:Cenpo UTSW 12 4215433 splice site probably null
R1916:Cenpo UTSW 12 4216683 missense probably benign 0.05
R2174:Cenpo UTSW 12 4217318 missense probably benign 0.00
R5384:Cenpo UTSW 12 4216646 missense probably damaging 1.00
R6211:Cenpo UTSW 12 4216733 missense probably benign 0.22
R6238:Cenpo UTSW 12 4231968 missense possibly damaging 0.76
R6630:Cenpo UTSW 12 4217236 unclassified probably benign
R6862:Cenpo UTSW 12 4216539 missense probably damaging 1.00
R7086:Cenpo UTSW 12 4215307 missense probably benign 0.00
R7087:Cenpo UTSW 12 4215307 missense probably benign 0.00
R7088:Cenpo UTSW 12 4215307 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCATTTGCTTGAACCAGAACATGCC -3'
(R):5'- AGCTGAGCAGTTCCACCTCTATCC -3'

Sequencing Primer
(F):5'- AGTGAGGCATTGTTCCTCATAC -3'
(R):5'- ACTTGGCAGAAATGGTATCTCCC -3'
Posted On2017-12-01